BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig202
         (996 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 1388.1    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 1388.14 bits (700.0), Expect = 0.0
Identities = 745/762 (98%)
Strand = Plus/Plus

Query: 180    GTGATCCTTCGACATTATTGAAGGGAGGGGGCTCGACCTGAAGCCTTTAAATAGAGTCCC 239
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 240861 GTGATCCTTCGACATTATTGAAGGGAGGGGGCTCGACCTGAAGCCTTTAAATAGAGTCCC 240920

Query: 240    ATCCGCCTCCCCGGTTCCACGCGCCCTTACTAGTAAAGGCTCCCATTGGGAGAAGCAGAA 299
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 240921 ATCCGCCTCCCCGGTTCCACGCGCCCTTACTAGTAAAGGCTCCCATTGGGAGAAGCAGAA 240980

Query: 300    ATTGTTGAGTGAGCGATCCGGCCTCTAGCCCTTCAATGATGGATTTGTCTTCNNNNNNNC 359
              ||||||||||||||||||||||||||||||||||||||||||||||||||||       |
Sbjct: 240981 ATTGTTGAGTGAGCGATCCGGCCTCTAGCCCTTCAATGATGGATTTGTCTTCAAAAAAAC 241040

Query: 360    CCCGACCTCGGTAGAAAACGAACGGCGGCGTGAAGTTGATGAGCAGGGAAGATGTCTTTT 419
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241041 CCCGACCTCGGTAGAAAACGAACGGCGGCGTGAAGTTGATGAGCAGGGAAGATGTCTTTT 241100

Query: 420    TTCTAGTTGGCCAAGCGGCCCCGTCTTCCATAGCCAGGGATTAGTCATTTAAGGATCAGT 479
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241101 TTCTAGTTGGCCAAGCGGCCCCGTCTTCCATAGCCAGGGATTAGTCATTTAAGGATCAGT 241160

Query: 480    TGATGCGCTGGGATGAAAGAAAGTTCTTCGGTGCTCCTCCGGGACGAACAGTAAAGGCAC 539
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241161 TGATGCGCTGGGATGAAAGAAAGTTCTTCGGTGCTCCTCCGGGACGAACAGTAAAGGCAC 241220

Query: 540    ATGAAGGTATTGGCTCTTACTATCGATCGGATGGAGAGAACCGCGGCGCTTTACCTTACG 599
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241221 ATGAAGGTATTGGCTCTTACTATCGATCGGATGGAGAGAACCGCGGCGCTTTACCTTACG 241280

Query: 600    AATATCTAAAGGCGAAGATCTCTTTTCGACTAGCAAGTTTACGTACCTAGGTCCTAAGTT 659
              |||||||||||||||||||| ||||||||||||||||||||||    |||||||||||||
Sbjct: 241281 AATATCTAAAGGCGAAGATCCCTTTTCGACTAGCAAGTTTACG----TAGGTCCTAAGTT 241336

Query: 660    TCTCATTACTCGGTGAAGTCTGATTTGAGCCCTGGTCAAACTGATCTCTCCGGCGGGCGG 719
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 241337 TCTCATTACTCGGTGAAGTCTGATTTGAGCCCTGGTCAAACTGATCCCTCCGGCGGGCGG 241396

Query: 720    AGGATGGTCTCATATTAGCAATGTTTTGATTGCGCCTATCTGTCGTTGCCAATGAACCGA 779
              ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 241397 AGGATGGTCTCATATTAGCAATGTTTTGATTGCGCCTATCTTTAGTTGCCAATGAACCGA 241456

Query: 780    TCACCAAGAGAAAGTATCTCTCTTAATCTTAAGGTGAAGCGCCTTTCAGCCAGCTGAAGG 839
              ||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 241457 TCACCAAGAGAAAGTCTCTCTCTTAATCTTAAGGTGAAGCGCGTTTCAGCCAGCTGAAGG 241516

Query: 840    AAGGTCGCGTTAGCGCCCCTGCAATCAGAAAGCCTTTTGATAACCTTACTACTAATAGAA 899
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241517 AAGGTCGCGTTAGCGCCCCTGCAATCAGAAAGCCTTTTGATAACCTTACTACTAATAGAA 241576

Query: 900    AGGGGAAAGATGCGCTCAATCCCTTGCTTCTTGCTCCAACTT 941
              ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241577 AGGGGAAAGATGCGCTCAATCCCTTGCTTCTTGCTCCAACTT 241622



Score = 57.9812 bits (29.0), Expect = 1.48629e-09
Identities = 32/33 (97%)
Strand = Plus/Plus

Query: 827    AGCCAGCTGAAGGAAGGTCGCGTTAGCGCCCCT 859
              |||| ||||||||||||||||||||||||||||
Sbjct: 331163 AGCCTGCTGAAGGAAGGTCGCGTTAGCGCCCCT 331195

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597