BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig96
         (1598 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 2054.2    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 2054.21 bits (1036.0), Expect = 0.0
Identities = 1144/1183 (97%)
Strand = Plus/Plus

Query: 3      CGGGAACCCTGATCTAGATACAGTAGGATCAATTGAGTTAGCAAATCTAATGTGCGTACA 62
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 318362 CGGGAACCCTGATCTAGACACAGTAGGATCAATTGAGTTAGCAAATCTAATGTGCGTACA 318421

Query: 63     AGCATCCCTTTCCTTTTATTTTGGAATTTGGCACTATTTAAATAAAAAATAACCTACAAT 122
              ||||||  |||||||||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 318422 AGCATCTTTTTCCTTTTATTTTTGAATTTGGCACTATTTAAATAAAAAAGAACCTACAAT 318481

Query: 123    AAGGTTTTCTTCCTTAAACACTAACCCGGCCAAGACTCACCAATAAGGTAACTCCGCCCT 182
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318482 AAGGTTTTCTTCCTTAAACACTAACCCGGCCAAGACTCACCAATAAGGTAACTCCGCCCT 318541

Query: 183    GTGTTTTTTGGATCAAATCCGGTGACAATTCTCCACTCATGTCCTTCCAGAGCTGGGTAA 242
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318542 GTGTTTTTTGGATCAAATCCGGTGACAATTCTCCACTCATGTCCTTCCAGAGCTGGGTAA 318601

Query: 243    GTGATCTTCAAGGGCATCTCCCCGATCCATTCTTCCCAGCGCCCCTCAATCAAATCCATA 302
              |||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||
Sbjct: 318602 GTGATCTTCAAGGGCATCTCCCCGATCCATTCTTCCCAGCGCTCCTCAATCAGATCCATA 318661

Query: 303    ACTGCTGTTGCTTGTGCAGGAGTAACTAGAGAACTTCAAATTGCAATAAAAAAGTTGTCA 362
              |||||||||||||||||||||||||||||||||||| ||||||||||   ||||||||||
Sbjct: 318662 ACTGCTGTTGCTTGTGCAGGAGTAACTAGAGAACTTAAAATTGCAAT---AAAGTTGTCA 318718

Query: 363    ACTAAGAAAGACCGGAAGTCCATGCGAGCCGGGCTGATATTAACCAAAAAGATACCCTCC 422
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318719 ACTAAGAAAGACCGGAAGTCCATGCGAGCCGGGCTGATATTAACCAAAAAGATACCCTCC 318778

Query: 423    TCAAAAGGGCCTGAAATCAAAGACCCAGTCAGGGATAGAGTTGAGAATGACATTAAAATT 482
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318779 TCGAAAGGGCCTGAAATCAAAGACCCAGTCAGGGATAGAGTTGAGAATGACATTAAAATT 318838

Query: 483    GAACAACTGTGTAGGAGTACTAATAAGTTTTGTAAGGGTATAGTTTATTTAATTGAGTGA 542
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318839 GAACAACTGTGTAGGAGTACTAATAAGTTTTGTAAGGGTATAGTTTATTTAATTGAGTGA 318898

Query: 543    AATTAGGCCAGTAGTCTTTCTGAATGTGATAGCTGAGAACTGTGATTCTTCGCTCGATCA 602
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318899 AATTAGGCCAGTAGTCTTTCTGAATGTGATAGCTGAGAACTGTGATTCTTCGCTCGATCA 318958

Query: 603    ATTCTTGCCATCACGCTCTGGCTTTAGCATCTGCCGAGCACATCTAAGCGAAAAATAGAA 662
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318959 ATTCTTGCCATCACGCTCTGGCTTTAGCATCTGCCGAGCACATCTAAGCGAAAAATAGAA 319018

Query: 663    AAAAGTGCCTGGATTTCAATTGGATACCCTTTTTCTCTGTTCCAGGTACAAGTCAAGTTG 722
              ||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 319019 AAAA----CTGGATTTCAATTGGATACCCTTTTTCTCTGTTCCAGGTACAAGTCAAGTTG 319074

Query: 723    AATTTACNNNNNNNNNTTCAGTGTTAGAAGTATTCAAATCCATAAATTCACTACGAAACA 782
              |||||||         ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 319075 AATTTACAAAAGAGAATTCAGTGTTAGAAGTATTCAAATCCATAAATTCACTACGAAACA 319134

Query: 783    AGGCCGGAACC--------AATTTGAGACTTTGGAAAACTTCAAATAGTAAACTGAAACT 834
              |||||||||||        ||||||||||||||||||||| ||||||||||||| |||||
Sbjct: 319135 AGGCCGGAACCAAGCCCTAAATTTGAGACTTTGGAAAACTGCAAATAGTAAACTTAAACT 319194

Query: 835    ATCAATCATATTAATATTACATCTATCTCCACATAGAAGTGTTGGAAAAGAAAGCTATCT 894
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 319195 ATCAATCATATTAATATTACATCCATCTCCACATAGAAGTGTTGGAAAAGAAAGCTATCT 319254

Query: 895    GAGAGGCAGAGGTTGACTATAAACTTCATCTCTCTCTGGACCTCAGGGAGTTTTTCCAGA 954
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 319255 GAGAGGCAGAGGTTGACTATAAACTTCATCTCTCTCTGGACCTCAGGGAGTTTTTCCAGA 319314

Query: 955    GCTGAATTGCGCGTGCACTTCTGCCAGAGCAGAATCACGTGTGTACTTGGTGTATAACCT 1014
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 319315 GCTGAATTGCGCGTGCACTTCTGCCAGAGCAGAATCACGTGTGTACTTGGTGTATAACCT 319374

Query: 1015   CAGCAGTATCTTCCATCAGAACCCAAAATCGGCAACGAATATGTCCTTTAGACTTTGCTA 1074
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 319375 CAGCAGTATCTTCCATCAGAACCCCAAATCGGCAACGAATATGTCCTTTAGACTTTGCTA 319434

Query: 1075   GAAATGGCCGAACACTAAAAAATCGGTGGAAAACCAGCTTAAGCTGGTTGTACTTTGAAG 1134
              ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 319435 GAAATGGCCGAACACTAAAAAATAGGTGGAAAACCAGCTTAAGCTGGTTGTACTTTTAAG 319494

Query: 1135   TTCGTTCAATTCACACAGGCAGGGTGATTGAGGTGCGTGCTTC 1177
              |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 319495 TTCGTTCAATTCACACAGGCAGGGTGATTGAGGTGCGTGCTTC 319544



Score = 819.205 bits (413.0), Expect = 0.0
Identities = 416/417 (100%)
Strand = Plus/Minus

Query: 1582  TTCTTCTTACACACAGAAGGTTTTTGCTCTCGTATTGCGGGTTTTCCACTTCGTTCAGTT 1523
             ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16445 TTCTTCTTAGACACAGAAGGTTTTTGCTCTCGTATTGCGGGTTTTCCACTTCGTTCAGTT 16504

Query: 1522  ACATTAGGGCTTTATACAACTCTACCTTGGTGATTAAGTTCCGCTTTAGTTGGTGTGAAA 1463
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16505 ACATTAGGGCTTTATACAACTCTACCTTGGTGATTAAGTTCCGCTTTAGTTGGTGTGAAA 16564

Query: 1462  TGAGCGGATTCTGGGATAGGAGGTCTTGTCGGTATGGAACCTACCCTTCCGGAGTGAAGG 1403
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16565 TGAGCGGATTCTGGGATAGGAGGTCTTGTCGGTATGGAACCTACCCTTCCGGAGTGAAGG 16624

Query: 1402  ATTGTCATCCTATAGCCGAGTGTTTTTAATTTGGTTTAGAGTCGAGTGATGAAGCTCATG 1343
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16625 ATTGTCATCCTATAGCCGAGTGTTTTTAATTTGGTTTAGAGTCGAGTGATGAAGCTCATG 16684

Query: 1342  ATTCTGCCGTTAGTGAGAAGCAAGTAAACTCTATAGCCCTAAACTAAAGGAGCAGGTCAA 1283
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16685 ATTCTGCCGTTAGTGAGAAGCAAGTAAACTCTATAGCCCTAAACTAAAGGAGCAGGTCAA 16744

Query: 1282  GTTCGTTCAGCTTGAGGGATAAATTACGTGGCTGACCTGCCAGTCCATCAAATATCGTAG 1223
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16745 GTTCGTTCAGCTTGAGGGATAAATTACGTGGCTGACCTGCCAGTCCATCAAATATCGTAG 16804

Query: 1222  TTTATCCTTAAGAGCAGGAGGTTCCTTGTGTGAAACTTAGATGTTGAAGCACGCACC 1166
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16805 TTTATCCTTAAGAGCAGGAGGTTCCTTGTGTGAAACTTAGATGTTGAAGCACGCACC 16861

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597