BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig92
         (1547 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 434.6    9.61884e-123
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 434.628 bits (219.0), Expect = 9.61884e-123
Identities = 318/351 (91%)
Strand = Plus/Plus

Query: 1      TATAGGCGTTGGAGGCCCTTAACCCTTTCTTATTATTAGTAAGATAGGTTGTCTTGGTTC 60
              ||||||| |||||||| |||||| ||||||||||||||| || |   |||||||| ||| 
Sbjct: 249307 TATAGGCCTTGGAGGCGCTTAACTCTTTCTTATTATTAGAAATAATTGTTGTCTTAGTTT 249366

Query: 61     CGTAACATGGTTCAAACCTGGCTTTTCATGAATATGGAACCCCATCCACTAGATTTAAGT 120
              | ||||||| ||||| || ||||||||||||||||||||||||||||||||||||| |||
Sbjct: 249367 CATAACATGTTTCAACCCCGGCTTTTCATGAATATGGAACCCCATCCACTAGATTTTAGT 249426

Query: 121    GCGCTGAATAATTGTCCTTTCCTCGTACGCATTTGAGTACTCAAGGCCCCCTTTCTTTTG 180
              | ||||||||||| || |     ||||| |   |  ||||  ||||||||||||||||||
Sbjct: 249427 GTGCTGAATAATTATCTT-----CGTACTCCAATCCGTACGAAAGGCCCCCTTTCTTTTG 249481

Query: 181    GCGGGTATCGCCACGTGGCTTAATCCCGGATCACTCCTTAAGGAATAGGACACAATAATA 240
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 249482 GCGGGTATCGCCACGTGGCTTAATCCCGGATCACTCCTTAAGGAATAGGACACAATAATA 249541

Query: 241    TAGCGCACATCAGAGAAGAGAGTACCCCCTTTATTATAAGACAGGCCCCCCGCGTCCTTT 300
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 249542 TAGCGCACATCAGAGAAGAGAGTACCCCCTTTATTATAAGACAGGCCCCCCGCGTCCTTT 249601

Query: 301    CTTAAGAGATGGAGCAATCGTCACTCGACAGCTCAAAACTGACCAGTACAA 351
              ||||||||||||||||||||||||||||||||||||| |||||| ||||||
Sbjct: 249602 CTTAAGAGATGGAGCAATCGTCACTCGACAGCTCAAAGCTGACCGGTACAA 249657



Score = 212.605 bits (107.0), Expect = 6.59025e-56
Identities = 135/143 (94%)
Strand = Plus/Plus

Query: 465    CAATCGTCACTCGACAGCTCAAAGCTGACCGGTACAACCCGCGTGCTTGCCTACTCGTCT 524
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 249616 CAATCGTCACTCGACAGCTCAAAGCTGACCGGTACAACCCGCGTGCTTGCCTACTCGTC- 249674

Query: 525    TTCACCGGCCTATTTGTACCCAGCTACAATCTCTTCCCTTATAAAAGAAAAAAGGG-CCC 583
                  |||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 249675 ----CCGGCCTATTTGTACCCAGCTACAATCTCTTCCCTTATAAAAGAAAAAAGGGCCCC 249730

Query: 584    TCGGCCAATCCTCAATCGACAGC 606
              |||||||||| ||| ||||||||
Sbjct: 249731 TCGGCCAATCGTCACTCGACAGC 249758



Score = 69.8753 bits (35.0), Expect = 6.09201e-13
Identities = 60/67 (90%)
Strand = Plus/Plus

Query: 315    CAATCGTCACTCGACAGCTCAAAA-CTGACCAGTACAAAACCATGTGATCTGTCCTCGTT 373
              |||||||||||||||||||| ||| | || ||||| ||||||||||||||||| || |||
Sbjct: 249736 CAATCGTCACTCGACAGCTCGAAAGCGGATCAGTAAAAAACCATGTGATCTGTACTTGTT 249795

Query: 374    TACGTAC 380
              |||||||
Sbjct: 249796 TACGTAC 249802



Score = 57.9812 bits (29.0), Expect = 2.31872e-09
Identities = 29/29 (100%)
Strand = Plus/Plus

Query: 456    CCCCTCGGCCAATCGTCACTCGACAGCTC 484
              |||||||||||||||||||||||||||||
Sbjct: 249727 CCCCTCGGCCAATCGTCACTCGACAGCTC 249755

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597