BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig82
         (978 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 1762.8    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 1762.81 bits (889.0), Expect = 0.0
Identities = 942/963 (98%)
Strand = Plus/Minus

Query: 953    CATTGNGCCCGGATNGNGGATTGATTGATNTAAACCAAAGACTTGATTATATATAGGAGA 894
              ||||| |||||||| | |||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 348122 CATTGAGCCCGGATTGAGGATTGATTGATCTAAACCAAAGACTTGATTATATATAGGAGA 348181

Query: 893    AAGGCGTTCTCATACCNTGATACCGCTTTGTGGAAACCTAGAACAGAAGAAAGTCTCTTT 834
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348182 AAGGCGTTCTCATACCCTGATACCGCTTTGTGGAAACCTAGAACAGAAGAAAGTCTCTTT 348241

Query: 833    AGGATGGCTCTGTCCTAGCTAGACCGAGTCACAACTACTTATTATAGAAGACTCAGGCAC 774
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348242 AGGATGGCTCTGTCCTAGCTAGACCGAGTCACAACTACTTATTATAGAAGACTCAGGCAC 348301

Query: 773    ACTTCCCTATACTTCTCCTAAGTGACATCAAAATACTCTTTCAGCCGATTCGAAAGCAGC 714
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348302 ACTTCCCTATACTTCTCCTAAGTGACATCAAAATACTCTTTCAGCCGATTCGAAAGCAGC 348361

Query: 713    AATAGATGAGATTGAATCAGACAGAAGGTTCACCCCTCACCCTGGGGGATTGGGGAGTTG 654
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348362 AATAGATGAGATTGAATCAGACAGAAGGTTCACCCCTCACCCTGGGGGATTGGGGAGTTG 348421

Query: 653    AGACTTCCTTGCTCTTAGGCCCGCTGTAAGGCCAATAAGATCAGGAAGAAGGGGATTGGA 594
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 348422 AGACTTCCTTGCTCTTAGGCCCGCTGTAAGGCCAATAAGATCAGGAAGAAGGAGATTGGA 348481

Query: 593    TTCTTCCTTTTATCCGGACTGACTCTAATCGTGATTTTGACTCTATTATGATACCTCCCT 534
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 348482 TTCTTCCTTTTATCCGGACTGACTCTAATCGTGATTTTTACTCTATTATGATACCTCCCT 348541

Query: 533    CTGTCGCAATAGAAATCGAGAATGGAGGTGACTTCGCTACACTTGTTTATAGTTGGAAAT 474
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348542 CTGTCGCAATAGAAATCGAGAATGGAGGTGACTTCGCTACACTTGTTTATAGTTGGAAAT 348601

Query: 473    TCCAACTCGAAGGCCCTAGTACTACTGACTTTGCACCAGATTAAATTGAAGCCTTTTTTC 414
              ||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||
Sbjct: 348602 TCCAACTCGAAGGCCCTAGTACTACTGACTTTGCACCAGAAACAATTGAAGCCTTTTTTC 348661

Query: 413    GGCATCCCTTCTCAGACGTCTTATTCCTTGCCTTAGTAATGTGCAATCAGCTACTTGGCA 354
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348662 GGCATCCCTTCTCAGACGTCTTATTCCTTGCCTTAGTAATGTGCAATCAGCTACTTGGCA 348721

Query: 353    CCTTCCCTTATTCTCCTTCCTTTCC----------GAGGTAGTACTAATTAATGCTTGAA 304
              |||||||||||||||||||||||||          |||||||||||||||||||||||||
Sbjct: 348722 CCTTCCCTTATTCTCCTTCCTTTCCTTTTAGATCTGAGGTAGTACTAATTAATGCTTGAA 348781

Query: 303    TTGCTCCTATTAGAAATAGGGCTACTCTTGGGTACGAAAGAAGGATATTCCGAGCCTGGG 244
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348782 TTGCTCCTATTAGAAATAGGGCTACTCTTGGGTACGAAAGAAGGATATTCCGAGCCTGGG 348841

Query: 243    CACATCCCTTTGATAGCTTTGTTTAGCCTCCTTTACTATGTCAATCCCTCCGTATTGGTT 184
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348842 CACATCCCTTTGATAGCTTTGTTTAGCCTCCTTTACTATGTCAATCCCTCCGTATTGGTT 348901

Query: 183    ATGGCTGAAGCCGATCCTCTCCTTGGTACTTCACCTAGTGGCTAATCTCAAGTCTCTTCT 124
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348902 ATGGCTGAAGCCGATCCTCTCCTTGGTACTTCACCTAGTGGCTAATCTCAAGTCTCTTCT 348961

Query: 123    CTCGACCGGATGGGCCTATGTCACTAGAACAGGTGAGGAAGGCCTCCAATCACTGTACTG 64
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 348962 CTCGACCGGATGGGCCTATGTCACTAGAACAGGTGAGGAAGACCTCCAATCACTGTACTG 349021

Query: 63     GCAATTCAAGATGAACTCCTTCCATGCCAACAATAATAGTACTAAACTTTCAAAAGAAGA 4
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 349022 GCAATTCAAGATGAACTCCTTCCATGCCAACAATAATAGTACTAAACTTTCAAAAGAAGA 349081

Query: 3      GAG 1
              |||
Sbjct: 349082 GAG 349084

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597