BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig79
         (1652 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 515.9    3.50948e-147
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 515.905 bits (260.0), Expect = 3.50948e-147
Identities = 266/268 (99%)
Strand = Plus/Plus

Query: 1      TCGGCGACCGCTCGACCTAGCGCGTTAGCCCCAGTACTATAGGGAAGGCCTATGCGAAGA 60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250753 TCGGCGACCGCTCGACCTAGCGCGTTAGCCCCAGTACTATAGGGAAGGCCTATGCGAAGA 250812

Query: 61     AAAGGCCTGCCCATCATCAAAGCAAGCCCAAGTCCATGCAAGAAGGCCCTCCAGATCTGT 120
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250813 AAAGGCCTGCCCATCATCAAAGCAAGCCCAAGTCCATGCAAGAAGGCCCTCCAGATCTGT 250872

Query: 121    CCAAATTCAAAGCCCGTCAAAGGCATATGAAATCATGCAAAGGATCCGAGCCCATCCAAA 180
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250873 CCAAATTCAAAGCCCGTCAAAGGCATATGAAATCATGCAAAGGATCCGAGCCCATCCAAA 250932

Query: 181    TGATGTTCAGCGGGCTAAACCCAAGTAGCTCTGGCCCATGATCCAAGAGACCCGAAACTC 240
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 250933 TGATGTTCAGCGGGCTAAACCCAAGTAGCTCTGGCCCATGATCCAAGAGACCCGAAACTA 250992

Query: 241    GTTCATCATGCTATCCTTACCTTCTAAC 268
              ||| ||||||||||||||||||||||||
Sbjct: 250993 GTTAATCATGCTATCCTTACCTTCTAAC 251020



Score = 228.464 bits (115.0), Expect = 1.18497e-60
Identities = 245/290 (84%)
Strand = Plus/Minus

Query: 1616   ATTAAAGCACTGGAAGAGAATCGCTATCGTCTTTCTAAA-GGACGGGG-------TGTAT 1565
              |||||||||||||||||||||||||||| |||||||||| ||||||||       | |||
Sbjct: 404279 ATTAAAGCACTGGAAGAGAATCGCTATCCTCTTTCTAAAAGGACGGGGATTTAGGTCTAT 404338

Query: 1564   TGCTTATGTCCGATTTGCTGACGCTAGCTTGACTTCACTCACTTCAGAGACAGNNNNNNN 1505
              ||||||||||||||||||||| |||||||||||||||||||||||||||| |        
Sbjct: 404339 TGCTTATGTCCGATTTGCTGAGGCTAGCTTGACTTCACTCACTTCAGAGAGA-------- 404390

Query: 1504   GAATAAGAGAATAAGAAAGGAGCGTAGCAGCC------AGAAAGAAATCCCCTCTTCCGC 1451
              ||| || |||||||||||||||||||||||||      ||||||||||||||||||||||
Sbjct: 404391 GAAAAAAAGAATAAGAAAGGAGCGTAGCAGCCAGAAAGAGAAAGAAATCCCCTCTTCCGC 404450

Query: 1450   TTAAGGCACCGAAGTCCCACAGCTAATATC--------TTGATTTAAGGGAAGTTCTTTC 1399
              ||||||||||||||||||  ||||||||||        | |||| |||||||||||||||
Sbjct: 404451 TTAAGGCACCGAAGTCCCTGAGCTAATATCAATAGCAGTAGATTCAAGGGAAGTTCTTTC 404510

Query: 1398   GTTAGCAGTAAGAGCCTATTCTGTCTTGCTTTCTGAATGAATTCCGCTGC 1349
                 ||||||||||||||||||||||||||||||||| | |||||||||||
Sbjct: 404511 TAGAGCAGTAAGAGCCTATTCTGTCTTGCTTTCTGATTCAATTCCGCTGC 404568



Score = 85.7341 bits (43.0), Expect = 1.09538e-17
Identities = 58/63 (92%)
Strand = Plus/Minus

Query: 142    CTTTGACGGGCTTTGAATTTGGACAGATCTGGAGGGCCTTCTTGCATGGACTTGGGCTTG 83
              |||||| |||||||||||||||| |||||  | |||||||||||||||||||||||||||
Sbjct: 369718 CTTTGATGGGCTTTGAATTTGGATAGATCCAGTGGGCCTTCTTGCATGGACTTGGGCTTG 369777

Query: 82     CTT 80
              |||
Sbjct: 369778 CTT 369780



Score = 44.1047 bits (22.0), Expect = 3.72627e-05
Identities = 28/30 (93%)
Strand = Plus/Plus

Query: 72     CATCATCAAAGCAAGCCCAAGTCCATGCAA 101
              ||||||||||||||| ||||| ||||||||
Sbjct: 137512 CATCATCAAAGCAAGTCCAAGCCCATGCAA 137541

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597