BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig77
         (2029 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 1384.2    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 1384.18 bits (698.0), Expect = 0.0
Identities = 760/781 (97%)
Strand = Plus/Minus

Query: 2012  TAGCCGCGAGCAATCTACGTTTGTGATCTCGTATATTTCGCTTCTCCGACATCTTACTGA 1953
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 43650 TAGCCGCGAGCAATCTACGTTTGTGATCTCGTATATTTCGCTTCTCCGACATCTTACTGA 43709

Query: 1952  GTTTCCCCCTCATCTTTTTGCAAAAAGCCGCTCCACGGTGGTAAAGTCTCATCTTGTGTG 1893
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 43710 GTTTCCCCCTCATCTTTTTGCAAAAAGCCGCTCCACGGTGGTAAAGTCTCATCTTGTGTG 43769

Query: 1892  TTGGCCGAAGTTACAATAGTAACATTGAACCCTCGAATATGTTCGAAGATCTCGAAATGA 1833
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 43770 TTGGCCGAAGTTACAATAGTAACATTGAACCCTCGAATATGTTCGAAGATCTCGAAATGA 43829

Query: 1832  TCTTCCAGTTCGGGGGAGAATTCGCAAAATTCCGTTTCCATCGAGAATTGAATTGACCTT 1773
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 43830 TCTTCCAGTTCGGGGGAGAATTCGCAAAATTCCGTTTCCATCGAGAATAGAATTGACCTT 43889

Query: 1772  TCCCTTATTTCGAGCGGAGAATCTAACAGAGACATTACTGTGGATATTCTGACCAAAAAA 1713
             ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 43890 TCCCTTATTTCGACCGGAGAATCTAACAGAGACATTACTGTGGATATTCTGACCAAAAAA 43949

Query: 1712  TGTGACATTCCATGCCCTCGGAGAGTGCTTTGTCGTGCTAGGTCACTGACATATCCTTTT 1653
             |  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 43950 TTAGACATTCCATGCCCTCGGAGAGTGCTTTGTCGTGCTAGGTCACTGACATATCCTTTT 44009

Query: 1652  TTGTCTTTATTTGACCCCAAGAATGGATTGGATCGAAACGACTTTCCTGTTGAAGCCCTT 1593
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 44010 TTGTCTTTATTTGACCCCAAGAATGGATTGGATCGAAACGACTTTCCTGTTGAAGCCCTT 44069

Query: 1592  ------TGTTTTAATTTCTGGCCGCACGGAATCTCCATAGCCAATTTTCCATTTTTGATA 1539
                   ||| |||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 44070 TGTGTCTGTATTAATTTCTGACCGCACGGAATCTCCATAGCCAATTTTCCATTTTTGATA 44129

Query: 1538  GAAGGTGCTGTCTTTGGTACTACTATTATTTTACACGATCCAGGAACTTCCATAACGTTG 1479
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 44130 GAAGGTGCTGTCTTTGGTACTACTATTATTTTACACGATCCAGGAACTTCCATAACGTTG 44189

Query: 1478  GCGTGATTCGGTTTGAGCAACGGATCCTGACGTGATACATCCTCGTAATGAAAATAGAGT 1419
             ||||||||||||||||||||| ||||||||||||| | ||  ||||||||||||||||||
Sbjct: 44190 GCGTGATTCGGTTTGAGCAACAGATCCTGACGTGAGAGATTTTCGTAATGAAAATAGAGT 44249

Query: 1418  GGAAACATGAGTTGATCCATAATGAGTATTAGATTGAAGTTCTCTTAAAGAAGACCGCCA 1359
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 44250 GGAAACATGAGTTGATCCATAATGAGTATTAGATTGAAGTTCTCTTAAAGAAGACCGCCA 44309

Query: 1358  ACTCCTATCCCGAAGATACAAAGCGCCCGGTCCTCTTCTCTTGTGTCGAAGTGTAGTGTA 1299
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 44310 ACTCCTATCCCGAAGATACAAAGCGCCCGGTCCTCTTCTCTTGTGTCGAAGTGTAGTGTA 44369

Query: 1298  GTGTGGTGAGGTTTTGCCTCACAGAAAGAGTGGGAAATTGGGATCAAAAAAGGCAGAATT 1239
             |||||||||||||||||||||||||||||||||||||||||||  |||||| | ||||||
Sbjct: 44370 GTGTGGTGAGGTTTTGCCTCACAGAAAGAGTGGGAAATTGGGAGAAAAAAACGAAGAATT 44429

Query: 1238  T 1238
             |
Sbjct: 44430 T 44430



Score = 254.234 bits (128.0), Expect = 2.5468e-68
Identities = 199/228 (87%)
Strand = Plus/Plus

Query: 7      AGCTGCCTGANGAGAGGAAGGGACGCCGGGTACAATCTTTCTTTGNTTCCAGCCCCCCGG 66
              |||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||||||
Sbjct: 215170 AGCTGCCTGATGAGAGGAAGGGACGCCGGGTACAGTCTTTCTTTGGTTCCAGCCCCCCGG 215229

Query: 67     TTACACCAAAGCACACCAGTCAACACTGTACTATAGCGCTTACACCTGTGAGTTGGCAAA 126
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  
Sbjct: 215230 TTACACCAAAGCACACCAGTCAACACTGTACTATAGCGCTTACACCTGTGAGGTGGCACG 215289

Query: 127    ATAATATCGTATGTTAATAAAAGACCTGAGTTGGCGNNNNNNNNNNNNNNNNNNNGCTAA 186
              |||||||||||| | ||||||| |||||||||||||                   |||||
Sbjct: 215290 ATAATATCGTATATAAATAAAACACCTGAGTTGGCG------AAATAAAAAAAAAGCTAA 215343

Query: 187    CGCTAACTAAGTGTTTAGTTACCATGCCCAAAAGCCCCATGCCTTTCC 234
              |||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 215344 CGCTAACTAAGTGTTTAGTTACCATGCCCAAAAGTCCCATGCCTTTCC 215397



Score = 99.6106 bits (50.0), Expect = 8.96067e-22
Identities = 65/70 (93%)
Strand = Plus/Plus

Query: 297    TAAGAAAGGACAAAGAAAAATGAATATCATGTTTACACCGATCGGATTTCAAAAAGTCCT 356
              ||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||||||
Sbjct: 260383 TAAGAAAGGACAAAGATTAATTAATATCATGTTTACACCGATCGGATTTCTAAAAGTCCT 260442

Query: 357    TCGACCCTTA 366
              ||| ||||||
Sbjct: 260443 TCGCCCCTTA 260452



Score = 99.6106 bits (50.0), Expect = 8.96067e-22
Identities = 65/70 (93%)
Strand = Plus/Minus

Query: 366    TAAGGGTCGAAGGACTTTTTGAAATCCGATCGGTGTAAACATGATATTCATTTTTCTTTG 307
              |||||| |||||||||||| |||||||||||||||||||||||||||| |||  ||||||
Sbjct: 318006 TAAGGGGCGAAGGACTTTTAGAAATCCGATCGGTGTAAACATGATATTAATTAGTCTTTG 318065

Query: 306    TCCTTTCTTA 297
              ||||||||||
Sbjct: 318066 TCCTTTCTTA 318075



Score = 55.9988 bits (28.0), Expect = 1.20447e-08
Identities = 31/32 (97%)
Strand = Plus/Minus

Query: 1972   CTTCTCCGACATCTTACTGAGTTTCCCCCTCA 1941
              |||||||||||||||||||| |||||||||||
Sbjct: 394212 CTTCTCCGACATCTTACTGACTTTCCCCCTCA 394243



Score = 52.0341 bits (26.0), Expect = 1.88059e-07
Identities = 65/78 (83%)
Strand = Plus/Plus

Query: 1144   ATTCTCCAGTTGGGTACAGTGCAAAGCCTTCCATTTCGGCGGGTTGAAAGGGCCATAAAG 1203
              |||||||| || ||||||   |||||| |||||||||||||| ||||||| ||||| || 
Sbjct: 156105 ATTCTCCATTTTGGTACACGCCAAAGCGTTCCATTTCGGCGGATTGAAAGAGCCATCAAT 156164

Query: 1204   GACTTTAATCTCTTTCTT 1221
               ||| | |||||||||||
Sbjct: 156165 CACTATGATCTCTTTCTT 156182

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597