BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig248
         (1903 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 1172.1    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 1172.06 bits (591.0), Expect = 0.0
Identities = 650/672 (97%)
Strand = Plus/Plus

Query: 1237  CGAGTGAATGACCTTAACGATCGTTTTAGAAGTAGCGCTTTACTAGCCTGACGACTCAAA 1296
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22097 CGAGTGAATGACCTTAACGATCGTTTTAGAAGTAGCGCTTTACTAGCCTGACGACTCAAA 22156

Query: 1297  GCAAGGTCGAAATCCATCCCTCTTTTTAAAACTGATTAATTAACGACCCACCAAGCAAGG 1356
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 22157 GCAAGGTCGAAATCCATCCCTCTTTTTAAAACTGATTAATTAACGACTCACCAAGCAAGG 22216

Query: 1357  GCACGTTGCGCGGTAGTAGCCAGTTCAAGGAAGTGAAACTAAGACAGGAAACTCCCCCNN 1416
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||   
Sbjct: 22217 GCACGTTGCGCGGTAGTAGCCAGTTCAAGGAAGTGAAACTAAGACAGGAAACTTCCCTTT 22276

Query: 1417  NNNNNGACTTTTTAGTAAGTAAGACCCTGTCCTCTTCCCTTTCGACATCAAGATAATTGA 1476
                   |||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22277 TTTTTTACTTTTAAGTAAGTAAGACCCTGTCCTCTTCCCTTTCGACATCAAGATAATTGA 22336

Query: 1477  CGAAGGTGGTGCTTTGAACATTTTCGCTGAAGTCGAAAAGATAAACATCTACCCGGTATA 1536
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22337 CGAAGGTGGTGCTTTGAACATTTTCGCTGAAGTCGAAAAGATAAACATCTACCCGGTATA 22396

Query: 1537  CCAGCAATCCTTCTATGCGGATACCCCTTTTTTACTCTCAACCATT-----GCCGAGAAG 1591
             ||||||||||||||||||||||||||||||||||||||||||||||     ||||||| |
Sbjct: 22397 CCAGCAATCCTTCTATGCGGATACCCCTTTTTTACTCTCAACCATTGCATTGCCGAGAGG 22456

Query: 1592  AGAAAATGCTCAAGGTTCTATATATTCTTTCTTTATTCAATTCATTCCTATCCTTTTTGT 1651
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22457 AGAAAATGCTCAAGGTTCTATATATTCTTTCTTTATTCAATTCATTCCTATCCTTTTTGT 22516

Query: 1652  TTTCAGTCCCGGGTTTCCTTTCCTCTCCAAGCCAATCAATCGCCTTCTTAGTTAACTGCG 1711
             ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 22517 TTTCAGTCCCGGGGTTCCTTTCCTCTCCAAGCCAATCGATCGCCTTCTTAGTTAACTGCG 22576

Query: 1712  GAACCCGCCCTTTAGCCATCTATCTTTAGATACGGAGGGCTTATGAGTCACAGAATTTGA 1771
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 22577 GAACCCGCCCTTTAGCCATCTATCTTTAGATACGGAGGGCTTATGAGTCACAGAATTTTA 22636

Query: 1772  AGCCCAAAAAACAAGGTAAGAAAGGTGGGGAACAGCGGCCTCACACAAAAAGATTTGTCT 1831
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22637 AGCCCAAAAAACAAGGTAAGAAAGGTGGGGAACAGCGGCCTCACACAAAAAGATTTGTCT 22696

Query: 1832  AAGCAATCTCAAAGAGATTTTCAATAAGTCAATACCAAGATTTTCTTTCTGCGCCTACTG 1891
             ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 22697 AAGCAATCTCAAAGAGATTTTCAATAAGTCAATACCAAGATTTGCTTTCTGCGCCTACTG 22756

Query: 1892  ATGTGATGATAA 1903
             ||||||||||||
Sbjct: 22757 ATGTGATGATAA 22768



Score = 821.187 bits (414.0), Expect = 0.0
Identities = 526/568 (93%)
Strand = Plus/Minus

Query: 1039   TTTGGCCTCTATTTCCTCTTCTCTCGTATCTGTCCATCTTTCTGATGGTGAAGGAAGAAA 980
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 341992 TTTGGCCTCCATTTCCTCTTCTCTCGTATCTGTCCATCTTTCTGATGGTGAAGGAAGAAA 342051

Query: 979    TTATGAATAGAATTGCGATAATGGAAACGAAGCATGCGGCAAGGCCTCCCAATC------ 926
              ||||||  | ||||||||||||||||||||||||||||||||||||||||||||      
Sbjct: 342052 TTATGACAATAATTGCGATAATGGAAACGAAGCATGCGGCAAGGCCTCCCAATCCAAGAA 342111

Query: 925    -------GGGAATCTTCGTTCCTCTTTTATGATGATGAATGGAACTGCTGTCCCGCGTAA 873
                     |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 342112 CCCAATCGGGAATCTTCGTTCCTCTTTTATGATGATGAATGGAACTGCTGTCCCGCGTAA 342171

Query: 872    GCCTTTGGAAGCAAACAATCGTAAAAAGGAAAAATAGAGAAGT---------AGAGCTAA 822
              ||||||||||||||||||||||||||||||||||| |||||||         ||||||||
Sbjct: 342172 GCCTTTGGAAGCAAACAATCGTAAAAAGGAAAAATCGAGAAGTAGTCTAAGTAGAGCTAA 342231

Query: 821    GGTAAAAAACATGGACAATCCTGTGTATTCGATCTAGTGCTCTCACTTGCCCCCAAGGGG 762
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 342232 GGTAAAAAACATGGACAATCCTGTGTATTCGATCTAGTGCTCTCACTTGCCCCCAAGGGG 342291

Query: 761    CCAGAAGAAGATACCCAATGTTCAGGGTAGAAAGCCAGGGTTTGGTACTTTGACGAGCTG 702
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 342292 CCAGAAGAAGATACCCAATGTTCAGGGTAGAAAGCCAGGGTTTGGTACTTTGACGAGCTG 342351

Query: 701    GCCGCCGAGAGAGCACTGAGACGAAGAACCTAGCTAGGAATTTCCCTGCCCGTGTCTACT 642
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 342352 GCCGCCGAGAGAGCACTGAGACGAAGAACCTAGCTAGGAATTTCCCTGCCCGTGTCTACT 342411

Query: 641    TCTTGAAAAACCTAAAGGGTCAAGGTAAGCGTATCAAGAGAAAATGAGCAA--------- 591
              ||||| |||||||||| || |||||||||||||||||||||||||||||||         
Sbjct: 342412 TCTTG-AAAACCTAAACGGGCAAGGTAAGCGTATCAAGAGAAAATGAGCAAAGCAAGGGG 342470

Query: 590    --AGCTTATGCCCGGCTAATTGAATGGAGTTCCCGGCTTTAAAGAATCAAGTTCAAGTAC 533
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 342471 AGAGCTTATGCCCGGCTAATTGAATGGAGTTCCCGGCTTTAAAGAATCAAGTTCAAGTAC 342530

Query: 532    CGAGGAGATTTATTTGAAGAGCTTTGGT 505
              |||||||||| |||||||||||||||||
Sbjct: 342531 CGAGGAGATTGATTTGAAGAGCTTTGGT 342559



Score = 139.258 bits (70.0), Expect = 9.75714e-34
Identities = 76/78 (97%)
Strand = Plus/Minus

Query: 504    TATGAATGAATAGGCATGTGGGAACAGCATTGCTTGCATTGATTCAATTGATTTGAAGTG 445
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 212296 TATGAATGAATAGGCATGTGGGAACAGCATTGCTTGCATTGATTCAATTGATTTGAAGCG 212355

Query: 444    GCGGTTATACTAAACATA 427
              |||||||||||| |||||
Sbjct: 212356 GCGGTTATACTATACATA 212373



Score = 59.9635 bits (30.0), Expect = 7.23176e-10
Identities = 30/30 (100%)
Strand = Plus/Plus

Query: 1294   AAAGCAAGGTCGAAATCCATCCCTCTTTTT 1323
              ||||||||||||||||||||||||||||||
Sbjct: 128327 AAAGCAAGGTCGAAATCCATCCCTCTTTTT 128356

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597