BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig246
         (1016 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 757.8    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 757.752 bits (382.0), Expect = 0.0
Identities = 394/398 (99%)
Strand = Plus/Minus

Query: 416   GAAATGCCATAACTCTCTTTCTGAATGTCTCGACTTTCTTTCTCAAACCACCGGACAGGG 357
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 36925 GAAATGCCATAACTCTCTTTCTGAATGTCTCGACTTTCTTTCTCAAACCACCGGACAGGG 36984

Query: 356   GTGCGGAAATAGCAACAATTCATGGTAGAGCGGAAATTGCTTCTGATTTGATTTCGCCTG 297
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 36985 GTGCGGAAATAGCAACAATTAATGGTAGAGCGGAAATTGCTTCTGATTTGATTTCGCCTG 37044

Query: 296   AAACGAATCCCTCGCTTTGATAAGAAATATCTGAGTAAACAACCTTTGAGCTGAGGTAAT 237
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 37045 AAACGAATCCCTCGCTTTGATAAGAAATATCTGAGTAAACAACCTTTGAGCTGAGGTAAT 37104

Query: 236   ATTCAATTTTGAGGGTTAGCTTTGCGTTCCTTGAGTATGTTTCTGCCCTAAACTAAGAAA 177
             |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 37105 ATTCCATTTTTAGGGTTAGCTTTGCGTTCCTTGAGTATGTTTCTGCCCTAAACTAAGAAA 37164

Query: 176   GAGTATAGTGCTCGTTTTGATAAGAGTATTACATACTATCTGCTGGAATGTTTTCAACGT 117
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 37165 GAGTATAGTGCTCGTTTTGATAAGAGTATTACATACTATCTGCTGGAATGTTTTCAACGT 37224

Query: 116   CCCCCTTATGCAACTACGGGAATTTCTTCTGGTTCGCTACTATCTTTTCCTACAGCTCAC 57
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 37225 CCCCCTTATGCAACTACGGGAATTTCTTCTGGTTCGCTACTATCTTTTCCTACAGCTCAC 37284

Query: 56    GGCTGACCTTGAACTGGCCAAAAAGCTTTCTATTTGAA 19
             | ||||||||||||||||||||||||||||||||||||
Sbjct: 37285 GACTGACCTTGAACTGGCCAAAAAGCTTTCTATTTGAA 37322



Score = 305.775 bits (154.0), Expect = 3.86683e-84
Identities = 182/191 (95%)
Strand = Plus/Minus

Query: 830   CCCCTTCGACTGAACGACGGAATTCTTTCACCGCGCTCTACTTCCTTAGGGGGATGAGAA 771
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 36742 CCCCTTCGACTGAACGACGGAATTCTTTCACCGCGCTCTACTTCCTTAGGGGGATGAGAA 36801

Query: 770   GG----CCAGTCCTCTCTCCTTCGGGCCCTTCTTTTCGATAAGGGGAGGCTATTCTTGAA 715
             ||    ||||| || ||| |||||| ||||||||||||||||||||||||||||||||||
Sbjct: 36802 GGATGGCCAGTTCTGTCTTCTTCGGACCCTTCTTTTCGATAAGGGGAGGCTATTCTTGAA 36861

Query: 714   AAGAATAGGTATGTTCAACTAGTTATTTGAACTATTCAATAAGAATAGGGATTTTCAATG 655
             |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 36862 AAGAATAGGTATATTCAACTAGTTATTTGAACTATTCAATAAGAATAGGGATTTTCAATG 36921

Query: 654   CTAGAAATGCC 644
             |||||||||||
Sbjct: 36922 CTAGAAATGCC 36932

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597