BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig212
         (1185 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 1328.7    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 1328.67 bits (670.0), Expect = 0.0
Identities = 685/690 (99%)
Strand = Plus/Plus

Query: 1      TCCATAGACGGAACTCTGTTTAGGTATTAGGGAGGGGAGGACACCACTCAGCACCGCTCC 60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329033 TCCATAGACGGAACTCTGTTTAGGTATTAGGGAGGGGAGGACACCACTCAGCACCGCTCC 329092

Query: 61     GTGGGGTGGGGTTCAATGCCTAACAAAAAGGGCCAAAAGCAAAAAAGGGATGTATGGCTG 120
              ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||
Sbjct: 329093 GTGGGGTGGGGTTCAATGCCTAACAAAAACGGCCAAAAGAAAAAAAGGGATGTATGGCTG 329152

Query: 121    AGGGGAGGAGAGAAAGAACGCATGCATGGAGATTCTGTCTGTCGGAGGTTCGAGAATCTA 180
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329153 AGGGGAGGAGAGAAAGAACGCATGCATGGAGATTCTGTCTGTCGGAGGTTCGAGAATCTA 329212

Query: 181    TGAAAGGACATCTAAGGCTAAGGTTACGAAGTAAAGGAAGTCCATTACTGAGAGAAGTGG 240
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329213 TGAAAGGACATCTAAGGCTAAGGTTACGAAGTAAAGGAAGTCCATTACTGAGAGAAGTGG 329272

Query: 241    TGATCTCGTCTTGCTTGCTGGGAGAGAGGAAGCTTCCGGACCATCTTTTCCAGCCAGATA 300
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329273 TGATCTCGTCTTGCTTGCTGGGAGAGAGGAAGCTTCCGGACCATCTTTTCCAGCCAGATA 329332

Query: 301    GCGAGCGATCACTCAGCAATGAACACTAACTGAAAGCGGCCGGGAATGAGTACCTATCCC 360
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329333 GCGAGCGATCACTCAGCAATGAACACTAACTGAAAGCGGCCGGGAATGAGTACCTATCCC 329392

Query: 361    TTACGGGAATCGAACCCGTGTCTTCGACATGAAAAGACGATGTCCTAACCACTGGACGAA 420
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329393 TTACGGGAATCGAACCCGTGTCTTCGACATGAAAAGACGATGTCCTAACCACTGGACGAA 329452

Query: 421    AGGGACCAAAAAGCCATTCTTCATATACCTCAGCTCCGAGAATAGAAGTGGTTCGTTTTC 480
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 329453 AGGGACCAAAAAGCCATTCTTCATATACCTCAGCTCCGAGAATAGAAGTGGTTCGTTTTG 329512

Query: 481    TTTCTATACGCAATTCAAGATTTCGTTTGTGTTCATGTTGGCGATTTCTGATGTGAATTC 540
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 329513 TTTCTATACGCAATTCAAGATTTCGTTTGTCTTCATGTTGGCGATTTCTGATGTGAATTC 329572

Query: 541    GGCGGGTCGTCCCCCCTTCCTACGGGTTCCCCCACCGACCCAGTGACACACCAACCACGC 600
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329573 GGCGGGTCGTCCCCCCTTCCTACGGGTTCCCCCACCGACCCAGTGACACACCAACCACGC 329632

Query: 601    CCCTTCTCTTTCTCCGATCATAAAGCCCCCTGATCCCTTTATTTGTCTTTCATCCCCCCT 660
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329633 CCCTTCTCTTTCTCCGATCATAAAGCCCCCTGATCCCTTTATTTGTCTTTCATCCCCCCT 329692

Query: 661    GAATAAGTAAGACCCCGCTCTTTCGAATTC 690
              |||||||||||||||||||||||| |||||
Sbjct: 329693 GAATAAGTAAGACCCCGCTCTTTCTAATTC 329722



Score = 648.723 bits (327.0), Expect = 0.0
Identities = 342/347 (99%)
Strand = Plus/Plus

Query: 723    GGTCCTGGGTCGTATCGTTTTTCAACTGTCCGCTGGTAAATCTGGTCTAGCACTACAATG 782
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 391487 GGTCCTGGGTCGTATCGTTTTTCAACTGTCCGCTGGTAAATCTGGTCTAGCACTACAATG 391546

Query: 783    TCTCCATTGTGCGGCGCTATGAAAGAGAAAAAGAATTCTGCCTCGCTAGCCTTTTCACCT 842
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 391547 TCTCGATTGTGCGGCGCTATGAAAGAGAAAAAGAATTCTGCCTCGCTAGCCTTTTCACCT 391606

Query: 843    CTTCTCTTCCGTCGGTCTTGTACTGAGCCATCAGAATAGGGATGGTGCCAAGAAAGGCAG 902
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 391607 CTTCTCTTCCGTCGGTCTTGTACTGAGCCATCAGAATAGGGATGGTGCCAAGAAAGGAAG 391666

Query: 903    TTTAATCTATATCTGTAGAACGAACAAAGCAAAGATATTCAAATAAAGAATTTGTGAGGG 962
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 391667 TTTAATCTATATCTGTAGAACGAACAAAGCAAAAATATTCAAATAAAGAATTTGTGAGGG 391726

Query: 963    AATGACTATTCATATATTGAATTTTCATCCAGGCAAGAAAAAGTCTATGGAAAGATGCTG 1022
              ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 391727 AATGACTATTCATCTATTGTATTTTCATCCAGGCAAGAAAAAGTCTATGGAAAGATGCTG 391786

Query: 1023   TATATGTCGCAGCCTTCTTAAACAAAATGAACGAAGGCCCAAGGGCT 1069
              |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 391787 TATATGTCGCAGCCTTCTTAAACAAAATGAACGAAGGCCCAAGGGCT 391833



Score = 155.117 bits (78.0), Expect = 1.01747e-38
Identities = 78/78 (100%)
Strand = Plus/Plus

Query: 1065   GGGCTTTTATCCATCAGACATGAATGAAAGGGGATGACACCACTCTAATGATTGGAAAAA 1124
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 392029 GGGCTTTTATCCATCAGACATGAATGAAAGGGGATGACACCACTCTAATGATTGGAAAAA 392088

Query: 1125   TCCTTAATATCATAAAGC 1142
              ||||||||||||||||||
Sbjct: 392089 TCCTTAATATCATAAAGC 392106

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597