BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig200
         (982 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 817.2    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 817.223 bits (412.0), Expect = 0.0
Identities = 456/471 (97%)
Strand = Plus/Plus

Query: 1      GCAGCTCTTTCAACTGCCGCCTAATCCCCCAACATGCTCAAGAACCGAGAGCCGTCCAGG 60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 325907 GCAGCTCTTTCAACTGCCGCCTAATCCCCCAACATGCTCAAGAACCGAGAGCCGTCCAGG 325966

Query: 61     GACTG-----CCGGAGGGAGCTTGCTTATAGAAAGAAGATAGGCC------AGAAAAACA 109
              |||||     |||||||||||||||||||||||||||||||||||      |||||||||
Sbjct: 325967 GACTGGACGGCCGGAGGGAGCTTGCTTATAGAAAGAAGATAGGCCGGTCAAAGAAAAACA 326026

Query: 110    AGGTGCAACGGGCTCTCCGCTCCTAGTCACTAAGAAGTGCTATTCTGTCCTCCGGGGGAC 169
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326027 AGGTGCAACGGGCTCTCCGCTCCTAGTCACTAAGAAGTGCTATTCTGTCCTCCGGGGGAC 326086

Query: 170    TGGACTCCACCAAGAGGTTCTTTCTCTCACGTAATTTCGCCCGCCCGTTTCATTTCCGTA 229
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 326087 TGGACTCCACCAAGAGGTTCTTTCTCTCACGTAATTTCGCCCGCCCCTTTCATTTCCGTA 326146

Query: 230    CCGGAGGAAATGGGATTCGAACCCATGATACAATCTTCTTGTATGTCGATTTAGCAAACC 289
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326147 CCGGAGGAAATGGGATTCGAACCCATGATACAATCTTCTTGTATGTCGATTTAGCAAACC 326206

Query: 290    AATGCCTTAAGCCACTCAGCCATACCTCCAAGTTGTTGATCGGAATGGAATTGGATGTGC 349
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 326207 AATGCCTTAAGCCACTCAGCCATACCTCCAAGTTGTTGATCGGAATAGAATTGGATGTGC 326266

Query: 350    CGGGTTTGGTTGCTTGCCCGAAGGAAGGGCTATCTGATCCGATCAACTACGTAAGCCGTA 409
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326267 CGGGTTTGGTTGCTTGCCCGAAGGAAGGGCTATCTGATCCGATCAACTACGTAAGCCGTA 326326

Query: 410    GCGCGCTAGCGCGCGTACTCTTCCTCTATGAGCGAGACTCCATCCAAATCT 460
              |||||||||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 326327 GCGCGCTAGCGCGCGTACTCTTCCTCTATGAGCGAGACTCTATCCAGATCT 326377



Score = 815.24 bits (411.0), Expect = 0.0
Identities = 479/505 (95%)
Strand = Plus/Plus

Query: 440    AGCGAGACTCCATCCAAATCTGCCACTCCTTGGGCGAGGCCTTCTGTTCTATGAACACCC 499
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326403 AGCGAGACTCCATCCAAATCTGCCACTCCTTGGGCGAGGCCTTCTGTTCTATGAACACCC 326462

Query: 500    CACCACTGAATGATTCACTTTCAAGTTCTCGCCTCCGACCCGGGAGAACACAGGGTCAAG 559
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326463 CACCACTGAATGATTCACTTTCAAGTTCTCGCCTCCGACCCGGGAGAACACAGGGTCAAG 326522

Query: 560    CCAAGCCCTGACCCGCCTAAATGGAATTCATATCTCCTTCGTCTGGTCGAGAAGGGAGGG 619
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326523 CCAAGCCCTGACCCGCCTAAATGGAATTCATATCTCCTTCGTCTGGTCGAGAAGGGAGGG 326582

Query: 620    GAACTGGACTCTGCCTCTTCTATTACATTTACATTACATTACGGAGAAGTCCATTCTCGT 679
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326583 GAACTGGACTCTGCCTCTTCTATTACATTTACATTACATTACGGAGAAGTCCATTCTCGT 326642

Query: 680    CATGATCGATCCACGTCCTAGCGTAGTGCCCGGCTTGCTTAGCAACCAAAGCTAGCTTAC 739
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326643 CATGATCGATCCACGTCCTAGCGTAGTGCCCGGCTTGCTTAGCAACCAAAGCTAGCTTAC 326702

Query: 740    TAAGGTAGTTTACTTTTTCATTTTGAAAAAAGAAGGCGAAGGGATTTTTCCTTGATTGCA 799
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 326703 TAAGGTAGTTTACTTTTTCATTTTGAAAAAAGAAGGCGAAGGCATTTTTCCTTGATTGCA 326762

Query: 800    CGAGCTAGCCAGCAAGCCAGCAAANNNNNNNNTTACTCACCTCAACATCTATNNNNNNNG 859
              ||||||||||||||||||||||||        ||||||||||||||||||||       |
Sbjct: 326763 CGAGCTAGCCAGCAAGCCAGCAAA-CCCCCCCTTACTCACCTCAACATCTATAAAAAGAG 326821

Query: 860    CTCTTTCTCCTTTTCATTTCATAATAATAANGGNAAGCATCCAGCTCTCGATCCANAGCT 919
              |||||||||||     |||||||||||||| || ||||||||||||||||||||| ||||
Sbjct: 326822 CTCTTTCTCCT-----TTTCATAATAATAA-GGTAAGCATCCAGCTCTCGATCCAGAGCT 326875

Query: 920    ACTGCTTCAAGAATCANCTGANCTC 944
              |||||||||||||||| |||| |||
Sbjct: 326876 ACTGCTTCAAGAATCAACTGAGCTC 326907



Score = 67.8929 bits (34.0), Expect = 1.52099e-12
Identities = 34/34 (100%)
Strand = Plus/Plus

Query: 711    GGCTTGCTTAGCAACCAAAGCTAGCTTACTAAGG 744
              ||||||||||||||||||||||||||||||||||
Sbjct: 311918 GGCTTGCTTAGCAACCAAAGCTAGCTTACTAAGG 311951

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597