BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig147
         (1199 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 737.9    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 737.929 bits (372.0), Expect = 0.0
Identities = 408/420 (97%)
Strand = Plus/Minus

Query: 428    AAATGGGACCGCGAAGACAGCCCACCACTGAAACTTGCTTTGCTCTCGCTCGGCTCGCTC 369
              ||||||||||||||||||| |||||||||  | |||||||||||||||||| ||||||||
Sbjct: 145568 AAATGGGACCGCGAAGACAACCCACCACTAGAGCTTGCTTTGCTCTCGCTCCGCTCGCTC 145627

Query: 368    CCACCTGTCTTCTTCCCACTATAGTGAAAGATCTTTCACTTCACCATAGCAGGAACCTCA 309
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 145628 CCACCTGTCTTCTTCCCACTATAGTGAAAGATCTTTCACTTCACCATAGCAGGAACCTCG 145687

Query: 308    CTAGCCTTCTCGGCCAGTTAGTCTAACCACAGGGATCCCTTCCTGCTTATCCACCCACCG 249
              ||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||
Sbjct: 145688 CTAACCTTCTCGGCCAGTTAGTCTAACCACAGGGATCCCCTCCTGCTTACCCACCCACCG 145747

Query: 248    TAAACGATTACTAACGAACTTGGAATACGAATGAGATCAAAAAGGCCATCATTGGGGCAA 189
              |||||  ||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 145748 TAAACTCTTACTAACGGACTTGGAATACGAATGAGATCAAAAAGGCCATCATTGGGGCAA 145807

Query: 188    ACGATGCAATAGCTTCGGTTAGAGCAAAGCCCAAAATGGCATAACCAAATAATTGTTTTG 129
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 145808 ACGATGCAATAGCTTCGGTTAGAGCAAAGCCCAAAATGGCATAACCAAATAATTGTTTTG 145867

Query: 128    CCAATGATGGATTTCGCGCCACGGAATGAATCGAGGAACTAAGGACGTTTCCAATACCGA 69
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 145868 CCAATGATGGATTTCGCGCCACGGAATGAATCGAGGAACTAAGGACGTTTCCAATACCGA 145927

Query: 68     TAGCAGCTCCCGCTGAAGCAATTGTAGCAGCTCCTGCACCCATTGATTTTGCACCTTCTA 9
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 145928 TAGCAGCTCCCGCTGAAGCAATTGTAGCAGCTCCTGCACCCATTGATTTTGCACCTTCTA 145987



Score = 377.14 bits (190.0), Expect = 1.50283e-105
Identities = 208/214 (97%)
Strand = Plus/Plus

Query: 986   ACCGGTCGTTAAGATAGAGTTGGTGTCGGTAGCTGTTCTTGCTTAGCGGGATCAGGTCAC 1045
             |||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||
Sbjct: 13030 ACCGGTCGTTAAGATAGAGTCGGTGTCGGTAGCAGTTCTTGCTTAGCGGGATCAGGTCAC 13089

Query: 1046  CAATCGGTGACATAGTTTAGGAATGAATATCTGTAACTCCCATTCCAGTACTTAAACTGA 1105
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 13090 CAATCGGTGACATAGTTTAGGAATGAATATCCGTAACTCCCATTCCAGTACTTAAACTGA 13149

Query: 1106  CAAAATGGAATAAACAATCAAGACCTGGCTCAAGGCTAACCCCTCCACACTCAGGGTCAG 1165
             |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 13150 CAAAATGGAATAAAAAATAAAGACCTGGCTCAAGGCTAACCCCTCCACACTCAGGGTCAG 13209

Query: 1166  GAACGGGAAAGGGAGAATGAGTAGGACAGGCTCG 1199
             |||||||||| |||||||||||||||||||||||
Sbjct: 13210 GAACGGGAAAAGGAGAATGAGTAGGACAGGCTCG 13243



Score = 186.834 bits (94.0), Expect = 2.91554e-48
Identities = 112/118 (95%)
Strand = Plus/Minus

Query: 427    AATGGGACCGCGAAGACAGCCCACCACTGAAACTTGCTTTGCTCTCGCTCGGCTCGCTCC 368
              |||||||||  ||||||| |||||||||| |||||||||||||||||||| ||||| |||
Sbjct: 389540 AATGGGACCAGGAAGACAACCCACCACTGGAACTTGCTTTGCTCTCGCTCCGCTCGTTCC 389599

Query: 367    CACCTGTCTTCTTCCCACTATAGTGAAAGATCTTTCACTTCACCATAGCAGGAACCTC 310
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 389600 CACCTGTCTTCTTCCCACTATAGTGAAAGATCTTTCACTTCACCATAGCAGGAACCTC 389657



Score = 159.081 bits (80.0), Expect = 6.59465e-40
Identities = 162/189 (86%)
Strand = Plus/Plus

Query: 19    AAAATCAATGGGTGCAGGAGCTGCTACAATTGCTTCAGCGGGAGCTGCTATCGGTATTGG 78
             ||||| ||| || ||||||||||||||||||||||||||||||||||||  |||||||||
Sbjct: 88129 AAAATTAATCGGCGCAGGAGCTGCTACAATTGCTTCAGCGGGAGCTGCTGCCGGTATTGG 88188

Query: 79    AAACGTCCTTAGTTCCTCGATTCATTCCGTGGCGCGAAATCCATCATTGGCAAAACAATT 138
             ||| ||  | |||||||    | |||| || ||| ||||||  |||||||||||||||||
Sbjct: 88189 AAATGTTTTCAGTTCCT----TAATTCTGTTGCGAGAAATCATTCATTGGCAAAACAATT 88244

Query: 139   ATTTGGTTATGCCATTTTGGGCTTTGCTCTAACCGAAGCTATTGCATCGTTTGCCCCAAT 198
             |||||||||||| |||||||| |||||| |||||||||||||||| | |||| ||  |||
Sbjct: 88245 ATTTGGTTATGCTATTTTGGGATTTGCTTTAACCGAAGCTATTGCCTTGTTTTCCTTAAT 88304

Query: 199   GATGGCCTT 207
             |||||||||
Sbjct: 88305 GATGGCCTT 88317



Score = 71.8576 bits (36.0), Expect = 1.19153e-13
Identities = 36/36 (100%)
Strand = Plus/Minus

Query: 44    TAGCAGCTCCTGCACCCATTGATTTTGCACCTTCTA 9
             ||||||||||||||||||||||||||||||||||||
Sbjct: 93273 TAGCAGCTCCTGCACCCATTGATTTTGCACCTTCTA 93308



Score = 48.0694 bits (24.0), Expect = 1.72616e-06
Identities = 24/24 (100%)
Strand = Plus/Plus

Query: 203    GCCTTTTTGATCTCATTCGTATTC 226
              ||||||||||||||||||||||||
Sbjct: 135053 GCCTTTTTGATCTCATTCGTATTC 135076



Score = 44.1047 bits (22.0), Expect = 2.69512e-05
Identities = 31/34 (91%)
Strand = Plus/Minus

Query: 228    TGGAATACGAATGAGATCAAAAAGGCCATCATTG 195
              |||||||||||||||||| | || ||||||||||
Sbjct: 320654 TGGAATACGAATGAGATCCACAATGCCATCATTG 320687

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597