BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig142
         (952 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 870.7    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 870.746 bits (439.0), Expect = 0.0
Identities = 551/593 (93%)
Strand = Plus/Plus

Query: 362   AGCTTCTTCCAAAGCATAGGGCTTTCTGGATGTAGATGATGATATCTATAGAGATGGATC 421
             |||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||
Sbjct: 17487 AGCTTCTTCCAAAGCATACGGCTTTCTGGATGTAGATGATGATATCTATACAGATGGATC 17546

Query: 422   TTATATATATCGTAGAATGAAGTAGCACATGGGTGGNNNNNNNNNNNN--CCAAATCTGC 479
             |||||||||||||||||||||||| |||||||||||              ||||||||||
Sbjct: 17547 TTATATATATCGTAGAATGAAGTACCACATGGGTGGATATATATATGAATCCAAATCTGC 17606

Query: 480   CGAATCACTCATGTTATGATCTTCTACATCCTGGGTCTTCCCGTTCCGTCATCTGACTTA 539
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 17607 CGAATCACTCATGTTATGATCTTCTACATCCTGGGTCTTCCCGTTCCGTCATCTGGCTTA 17666

Query: 540   TGTTCTTCATCTAGCATTCAGACCGAATGACTCTATGAAATTAGGTCGATACTTCCACAT 599
             |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 17667 TGTTCTTCATGTAGCATTCAGACCGAATGACTCTATGAAATTACGTCGATACTTCCACAT 17726

Query: 600   ATTATGGGTAAGGTAGGAGACATCTCTATTTTTCCCCGGGGGAATCTTTTGAATTCCCAC 659
             ||||||||||| ||||||||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 17727 ATTATGGGTAACGTAGGAGACATCTCTATTTTTCCCCCGGGGAATCTTTAGAATTCCCAC 17786

Query: 660   TGCTTAGCTTTCAATTCGCCTCTGACCATCAAATGAAATGTGAATAACCCGTCCTACTCT 719
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 17787 TGCTTAACTTTCAATTCGCCTCTGACCATCAAATGAAATGTGAATAACCCGTCCTCCTCT 17846

Query: 720   CTTTGAAAGAAGGGGCGCTTCCGGTTCTGTCGGTGCTTGAAAGAATTTTATCTTCTCCAT 779
             |||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||
Sbjct: 17847 CTTTGAAAGAAGGGGCGCTTCCGGTTCTGTCGGTGCTTGAAACAATTTTGTCTTCTCCAT 17906

Query: 780   ATTACTATATCTCGTCAGTCAATAATTTTTTATGAGGAACTACTGAACTCAATCACTTGC 839
             |||||||||||||   ||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 17907 ATTACTATATCTCTAGAGTCAATAATTTTATATGAGGAACTACTGAACTCAATCACTTGC 17966

Query: 840   TGCCCTTACTCTTCAGTTTTCTGTTGAGGTCTATCCTGCANAGGTACTCAAATTGGATCA 899
             |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 17967 TGCCGTTACTCTTCAGTTTTCTGTTGAGGTCTATCCTGCAGAGGTACTCAAATTGGATCA 18026

Query: 900   GTGATCGATTTCTNNNNTTCGTCGTAAACAAAATTTTTTATTTCAAATTACGT 952
             |||||||||||||    ||||||||||||  ||||  ||||||| ||||||||
Sbjct: 18027 GTGATCGATTTCTAGGTTTCGTCGTAAACCTAATTGGTTATTTCCAATTACGT 18079



Score = 301.811 bits (152.0), Expect = 5.65179e-83
Identities = 222/246 (90%)
Strand = Plus/Minus

Query: 247    ATAGTACCGGAGTCGTTCAAAGAGCCCTTCTTTCTATTCTGTTTTGTGCGTGTCAACTAT 188
              |||| |||||||||||  ||||||||||||||||||||     |||||||||||||||||
Sbjct: 169852 ATAGCACCGGAGTCGTGAAAAGAGCCCTTCTTTCTATT-----TTGTGCGTGTCAACTAT 169906

Query: 187    TGATTCTATGCCATCAAAGCATGCTAACAGCAGAAAAGAAATGCAAGTACATACAACTGC 128
              |||||||||||||||||||||||||||||||||||     ||||||||||||||||||||
Sbjct: 169907 TGATTCTATGCCATCAAAGCATGCTAACAGCAGAA-----ATGCAAGTACATACAACTGC 169961

Query: 127    GGTAATGCCGCATCATTGATAAAGAACCTTGCCATCCCCAGCTTTGTCCCCTGCAACAAG 68
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||   |||
Sbjct: 169962 GGTAATGCCGCATCGTTGATAAAGAACCTTGCCATCCCCAGCTTTGTCCCCTGCTTAAAG 170021

Query: 67     TTCATTGGCATATTCCCCTTCCCCTTCTATTCCCAAAAGCTGATTCAATAGGCTTCCTTT 8
              |||||||||||||||||||||||||||||||||||       ||||||||||||||||||
Sbjct: 170022 TTCATTGGCATATTCCCCTTCCCCTTCTATTCCCA-------ATTCAATAGGCTTCCTTT 170074

Query: 7      ATTGAT 2
              ||||||
Sbjct: 170075 ATTGAT 170097



Score = 48.0694 bits (24.0), Expect = 1.36752e-06
Identities = 30/32 (94%)
Strand = Plus/Minus

Query: 365   AGCTCGAAAAACTGTTTGGGAATTGATCAAAA 334
             |||||||||||  |||||||||||||||||||
Sbjct: 17436 AGCTCGAAAAAGAGTTTGGGAATTGATCAAAA 17467

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597