BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig130
         (1974 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 1937.2    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 1937.25 bits (977.0), Expect = 0.0
Identities = 1018/1034 (98%)
Strand = Plus/Minus

Query: 1034 TAAACTTCGACCCTTATTTCTTTCTTCATATTGTAAAGGGGAGCAAAGCCCGTTTTTTGC 975
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6048 TAAACTTCGACCCTTATTTCTTTCTTCATATTGTAAAGGGGAGCAAAGCCCGTTTTTTGC 6107

Query: 974  TCCCTCTATTGATAGAAAAAGGGCACTCCTGCCGTCGTTTCAGTGACTCATAGGGCTTCC 915
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6108 TCCCTCTATTGATAGAAAAAGGGCACTCCTGCCGTCGTTTCAGTGACTCATAGGGCTTCC 6167

Query: 914  CTCAGCGCAGTCTTTTTCGTTCTTGAGAATGGTCGCCACTTCTACCAGGACCGGAATGAT 855
            |||||| |||||||||| ||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 6168 CTCAGCTCAGTCTTTTTGGTTCTTGAGAATGGTCGCCACTTCTCCCAGGACCGGAATGAT 6227

Query: 854  TATCCCTGCCCGATGGGTCTACATCCATCCCTGAATGTCGTCGGGTACTGTTAACTTCCC 795
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6228 TATCCCTGCCCGATGGGTCTACATCCATCCCTGAATGTCGTCGGGTACTGTTAACTTCCC 6287

Query: 794  CGCCATTCTTGTAACTGTCACCTGTAATCCGCGCAGGTGTGTCCGCACCCCCCTGAGTGG 735
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6288 CGCCATTCTTGTAACTGTCACCTGTAATCCGCGCAGGTGTGTCCGCACCCCCCTGAGTGG 6347

Query: 734  ACGAGAAAGAAAGGATTTCTCGGAGCAACCCCCCAGGTTCCAGACCCAGGAGTCAACTTT 675
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 6348 ACGAGAAAGAAAGGATTTCTCGGAGCAACCCCCCAGGTTCCAGACCCAGGAGTAAACTTT 6407

Query: 674  CCCGTATGAGCATTCGGTACATGTATCAGTCCGTGGAAGAGTGAAAGGGTCACCACTACT 615
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6408 CCCGTATGAGCATTCGGTACATGTATCAGTCCGTGGAAGAGTGAAAGGGTCACCACTACT 6467

Query: 614  GAGGATNNNNNNNTAATCTTAGATAGGTCGTCTGAGGGTTCGCCGCGGTTCATTGCTGTG 555
            ||||||       |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6468 GAGGATCCCCCCCTAATCTTAGATAGGTCGTCTGAGGGTTCGCCGCGGTTCATTGCTGTG 6527

Query: 554  CTTACACACAAGGCTACCCTTTTCCGAAAGCTCCGCAGGACCACCTACCACTAGTCTTCG 495
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6528 CTTACACACAAGGCTACCCTTTTCCGAAAGCTCCGCAGGACCACCTACCACTAGTCTTCG 6587

Query: 494  GCCGGAGGGGTTTATTGCACAAAAAGGCCGGGGCGCAGGCTCCCGAAGAGAGAAGCCCAA 435
            ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 6588 GCCGGAGGGGTTTATTGCACAAAAACGCCGGGGCGCAGGCTCCCGAAGAGAGAAGCCCAA 6647

Query: 434  CGAATGTCAGATGCAAAGCCCCGCACCTCATTAAGATCATATTGGCATACTCTCCCAAAA 375
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6648 CGAATGTCAGATGCAAAGCCCCGCACCTCATTAAGATCATATTGGCATACTCTCCCAAAA 6707

Query: 374  AAGAAAGAGCAGACCCCATTGAAGACGAGAGTGAGGTACAACAAGGCCATTTCTGTCCAC 315
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6708 AAGAAAGAGCAGACCCCATTGAAGACGAGAGTGAGGTACAACAAGGCCATTTCTGTCCAC 6767

Query: 314  CGCCCTTCTCACGGAGCCGTACGTGGACGTTACCGCTCATACAGCTCCCAGCCAGCAAGC 255
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6768 CGCCCTTCTCACGGAGCCGTACGTGGACGTTACCGCTCATACAGCTCCCAGCCAGCAAGC 6827

Query: 254  AGTTAGCCTTCCTCTACAAGGAATGGAAGTGTGGATGAATCGACATCAAATATAGGATTG 195
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6828 AGTTAGCCTTCCTCTACAAGGAATGGAAGTGTGGATGAATCGACATCAAATATAGGATTG 6887

Query: 194  TTGTTGTACACGATCTCCATTTTAGTAGTCCTAGCTATCCACTCCACTATGTGGTAGAGT 135
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6888 TTGTTGTACACGATCTCCATTTTAGTAGTCCTAGCTATCCACTCCACTATGTGGTAGAGT 6947

Query: 134  GTTCGTCCCAACCCCTTCGCAGGGGTACCTTCCCTTTTAATTGAGAGAAGGACTCGGAAT 75
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6948 GTTCGTCCCCACCCCTTCGCAGGGGTACCTTCCCTTTTAATTGAGAGAAGGACTCGGAAT 7007

Query: 74   TGACTCCCCTCGATTCGAGATCCGAAAGAAGGGTATAGAGTTTATCCAAGGAATGCTCTC 15
            | |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||
Sbjct: 7008 TTACTCCCCTCGATTCGAGATCCGAAAGAAGGGTATGGAGTTTCTCCAAGGAATGCTCTC 7067

Query: 14   CCGTGGCGGTACGC 1
            ||||||||||||||
Sbjct: 7068 CCGTGGCGGTACGC 7081



Score = 1505.1 bits (759.0), Expect = 0.0
Identities = 774/779 (99%)
Strand = Plus/Plus

Query: 1194  CCGGTATGCCGCTCCGCCAGCAAGGAGCGAAAGAACCAAGTTTTCTGTGGTGATGTCAGA 1253
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86343 CCGGTATGCCGCTCCGCCAGCAAGGAGCGAAAGAACCAAGTTTTCTGTGGTGATGTCAGA 86402

Query: 1254  ATTTGCACCTATTTGTATCTATTTAGTGATCAGCCCGCTAGTTTCTTTGATCCCACTCGG 1313
             ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||
Sbjct: 86403 ATTTGCACCTATTTGTATCTATTTAGTGATCAGTCCGCTAGTTTCTTTGCTCCCACTCGG 86462

Query: 1314  TCTTCCTTTTCTATTTTCTTCCAATAGTTCGACCTATCCAGAAAAATTGTCGGCCTACGA 1373
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86463 TCTTCCTTTTCTATTTTCTTCCAATAGTTCGACCTATCCAGAAAAATTGTCGGCCTACGA 86522

Query: 1374  ATGTGGTTTCGATCCTTCCGGTGATGCCAGAAGTCGTTTTGATATAAGATTTTATCTTGT 1433
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86523 ATGTGGTTTCGATCCTTCCGGTGATGCCAGAAGTCGTTTTGATATAAGATTTTATCTTGT 86582

Query: 1434  TTCCATTTTATTTATTATTCCTGATCCGGAAGTAACCTTTTCCTTTCCTTGGGCAGTACC 1493
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86583 TTCCATTTTATTTATTATTCCTGATCCGGAAGTAACCTTTTCCTTTCCTTGGGCAGTACC 86642

Query: 1494  TCCCAACAAGATTGATCCATTTGGATCTTGGTCCATGATGGCCTTTTTATTGATTTTGAC 1553
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 86643 TCCCAACAAGATTGATCCGTTTGGATCTTGGTCCATGATGGCCTTTTTATTGATTTTGAC 86702

Query: 1554  GATTGGATCTCTCTATGAATGGAAAAGGGGTGCTTCGGATCGGGAGTAACCACTAGTGAT 1613
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 86703 GATTGGATCTCTCTATGAATGGAAAAGGGGTGCTTCGGATCGGGAGTAACCACTAGTGAG 86762

Query: 1614  AGGGCAAAAATAGGGGGGAAGGACAAAGGAAAGAGCGATGCCTACATTAAATCAATTGAT 1673
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86763 AGGGCAAAAATTGGGGGGAAGGACAAAGGAAAGAGCGATGCCTACATTAAATCAATTGAT 86822

Query: 1674  TCGTCATGGTAGAGAAGAAAAACGGCGCACGGACCGTACTCGAGCTTTGGATCAATGTCC 1733
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86823 TCGTCATGGTAGAGAAGAAAAACGGCGCACGGACCGTACTCGAGCTTTGGATCAATGTCC 86882

Query: 1734  CCAGAAGCAAGGAGTATGCCCGCGTGTTTCAACGAGAACACCGAAAAAACCTAATTCAGC 1793
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86883 CCAGAAGCAAGGAGTATGCCCGCGTGTTTCAACGAGAACACCGAAAAAACCTAATTCAGC 86942

Query: 1794  TCCACGTAAGATAGCCAAAGTACGGTTGAGCAATCGACATGATATATTTGCTCACATTCC 1853
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86943 TCCACGTAAGATAGCCAAAGTACGGTTGAGCAATCGACATGATATATTTGCTCACATTCC 87002

Query: 1854  AGGCGAAGGTCATAATTTGCAGGAACATTCTATGGTCTTAATAAGAGGAGGTAGAGTGAA 1913
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 87003 AGGCGAAGGTCATAATTTGCAGGAACATTCTATGGTCTTAATAAGAGGAGGTAGAGTGAA 87062

Query: 1914  AGATTCGCCAGGTGTGAAATTCCATTGTATTCGAGGAGTCAAGGATTTGCTGGGAATTC 1972
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 87063 AGATTCGCCAGGTGTGAAATTCCATTGTATTCGAGGAGTCAAGGATTTGCTGGGAATTC 87121



Score = 829.117 bits (418.0), Expect = 0.0
Identities = 433/438 (99%)
Strand = Plus/Plus

Query: 1194   CCGGTATGCCGCTCCGCCAGCAAGGAGCGAAAGAACCAAGTTTTCTGTGGTGATGTCAGA 1253
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 287843 CCGGTATGCCGCTCCGCCAGCAAGGAGCGAAAGAACCAAGTTTTCTGTGGTGATGTCAGA 287902

Query: 1254   ATTTGCACCTATTTGTATCTATTTAGTGATCAGCCCGCTAGTTTCTTTGATCCCACTCGG 1313
              ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||
Sbjct: 287903 ATTTGCACCTATTTGTATCTATTTAGTGATCAGTCCGCTAGTTTCTTTGCTCCCACTCGG 287962

Query: 1314   TCTTCCTTTTCTATTTTCTTCCAATAGTTCGACCTATCCAGAAAAATTGTCGGCCTACGA 1373
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 287963 TCTTCCTTTTCTATTTTCTTCCAATAGTTCGACCTATCCAGAAAAATTGTCGGCCTACGA 288022

Query: 1374   ATGTGGTTTCGATCCTTCCGGTGATGCCAGAAGTCGTTTTGATATAAGATTTTATCTTGT 1433
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 288023 ATGTGGTTTCGATCCTTCCGGTGATGCCAGAAGTCGTTTTGATATAAGATTTTATCTTGT 288082

Query: 1434   TTCCATTTTATTTATTATTCCTGATCCGGAAGTAACCTTTTCCTTTCCTTGGGCAGTACC 1493
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 288083 TTCCATTTTATTTATTATTCCTGATCCGGAAGTAACCTTTTCCTTTCCTTGGGCAGTACC 288142

Query: 1494   TCCCAACAAGATTGATCCATTTGGATCTTGGTCCATGATGGCCTTTTTATTGATTTTGAC 1553
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 288143 TCCCAACAAGATTGATCCGTTTGGATCTTGGTCCATGATGGCCTTTTTATTGATTTTGAC 288202

Query: 1554   GATTGGATCTCTCTATGAATGGAAAAGGGGTGCTTCGGATCGGGAGTAACCACTAGTGAT 1613
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 288203 GATTGGATCTCTCTATGAATGGAAAAGGGGTGCTTCGGATCGGGAGTAACCACTAGTGAG 288262

Query: 1614   AGGGCAAAAATAGGGGGG 1631
              ||||||||||| ||||||
Sbjct: 288263 AGGGCAAAAATTGGGGGG 288280



Score = 89.6988 bits (45.0), Expect = 8.39568e-19
Identities = 52/53 (98%)
Strand = Plus/Minus

Query: 1146   GGAACGAAGAACGAAACTTTACGACAGCTTTTTCGTAGACGTTCGACTTGCAT 1094
              |||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 378048 GGAACGAAGAACGAAACTTTACGACAGCTTTTTCGTAGACGTTC-ACTTGCAT 378100



Score = 85.7341 bits (43.0), Expect = 1.31085e-17
Identities = 43/43 (100%)
Strand = Plus/Plus

Query: 1066   GAAGGAACGCTAGCTATATGCTTAACACATGCAAGTCGAACGT 1108
              |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 108368 GAAGGAACGCTAGCTATATGCTTAACACATGCAAGTCGAACGT 108410



Score = 81.7694 bits (41.0), Expect = 2.04667e-16
Identities = 51/53 (96%)
Strand = Plus/Plus

Query: 1094   ATGCAAGTCGAACGTCTACGAAAAAGCTGTCGTAAAGTTTCGTTCTTCGTTCC 1146
              |||||||| |||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 192018 ATGCAAGT-GAACGTTTACGAAAAAGCTGTCGTAAAGTTTCGTTCTTCGTTCC 192070



Score = 59.9635 bits (30.0), Expect = 7.50371e-10
Identities = 36/38 (95%)
Strand = Plus/Plus

Query: 1035   TCTTGGGTTAGGGTGAAATCCGGAGATCTACGAAGGAA 1072
              ||||||||  ||||||||||||||||||||||||||||
Sbjct: 216659 TCTTGGGTCGGGGTGAAATCCGGAGATCTACGAAGGAA 216696



Score = 55.9988 bits (28.0), Expect = 1.17158e-08
Identities = 28/28 (100%)
Strand = Plus/Plus

Query: 1079  CTATATGCTTAACACATGCAAGTCGAAC 1106
             ||||||||||||||||||||||||||||
Sbjct: 66139 CTATATGCTTAACACATGCAAGTCGAAC 66166



Score = 55.9988 bits (28.0), Expect = 1.17158e-08
Identities = 28/28 (100%)
Strand = Plus/Plus

Query: 1045   GGGTGAAATCCGGAGATCTACGAAGGAA 1072
              ||||||||||||||||||||||||||||
Sbjct: 109018 GGGTGAAATCCGGAGATCTACGAAGGAA 109045



Score = 55.9988 bits (28.0), Expect = 1.17158e-08
Identities = 28/28 (100%)
Strand = Plus/Plus

Query: 1079   CTATATGCTTAACACATGCAAGTCGAAC 1106
              ||||||||||||||||||||||||||||
Sbjct: 416889 CTATATGCTTAACACATGCAAGTCGAAC 416916



Score = 52.0341 bits (26.0), Expect = 1.82923e-07
Identities = 26/26 (100%)
Strand = Plus/Minus

Query: 1105   TTCGACTTGCATGTGTTAAGCATATA 1080
              ||||||||||||||||||||||||||
Sbjct: 107104 TTCGACTTGCATGTGTTAAGCATATA 107129



Score = 44.1047 bits (22.0), Expect = 4.45924e-05
Identities = 25/26 (96%)
Strand = Plus/Minus

Query: 1220  CTCCTTGCTGGCGGAGCGGCATACCG 1195
             ||||||||| ||||||||||||||||
Sbjct: 19896 CTCCTTGCTCGCGGAGCGGCATACCG 19921

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597