BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig103
         (1300 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 672.5    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 672.511 bits (339.0), Expect = 0.0
Identities = 450/490 (92%)
Strand = Plus/Minus

Query: 985   AGTCAGAAGCCCTTATAGCAAGTGCTAGCTCTATTTATCCTATTGGGATTGGAGCAAGAG 926
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15474 AGTCAGAAGCCCTTATAGCAAGTGCTAGCTCTATTTATCCTATTGGGATTGGAGCAAGAG 15533

Query: 925   TGGAATGGAAGAAAGAAAGCAGTCCTTATCTTCTTCTTCT-------CCTCCTCCCGACA 873
             |||||||||||||||||||| ||||||||||||| || |        |||||||||||||
Sbjct: 15534 TGGAATGGAAGAAAGAAAGCTGTCCTTATCTTCTCCTCCAACCGCTACCTCCTCCCGACA 15593

Query: 872   TGAAGGAATGCCCGATAATCCTTCGGGGGCTGGTATGTCCTTTCAGTTCTGGTCTGGGGA 813
             ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15594 TGAAGGAATGCCCAATAATCCTTCGGGGGCTGGTATGTCCTTTCAGTTCTGGTCTGGGGA 15653

Query: 812   ACGCCGATCAGAGAAAGCACTCCTATACTGCCTGGTGTTGATTCGGCAATTTGCGTCTAG 753
             | |||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15654 AGGCCGATCAAAGAAAGGACTCCTATACTGCCTGGTGTTGATTCGGCAATTTGCGTCTAG 15713

Query: 752   TGGGGAGCTTTGTCATCTCAAAGAATAAGCGGATCTTCCCTTGCATGCGGATCTTAAAGT 693
             |||||||||||||||||||||||||||||||||||||             ||||| ||||
Sbjct: 15714 TGGGGAGCTTTGTCATCTCAAAGAATAAGCGGATCTT------------AATCTTTAAGT 15761

Query: 692   CGTGGATCTTTTGATGGCCGGTAGCTGCTTTCTGCTCTCCTTA-----TTAGTGCCAACT 638
             |||||||||  ||||||| | ||||||||||||||||||||||     ||||||||||||
Sbjct: 15762 CGTGGATCTCCTGATGGCGGCTAGCTGCTTTCTGCTCTCCTTATTAGTTTAGTGCCAACT 15821

Query: 637   CCGCTAGGTATAGGGAGGGAGTCTTCTACAAGTCGCATTACTGGTCGATGACCTGATTTT 578
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15822 CCGCTAGGTATAGGTAGGGAGTCTTCTACAAGTCGCATTACTGGTCGATGACCTGATTTT 15881

Query: 577   GGAAGCAGTCGAGATGCCTTTCCTGGGGGAACCCTTCCTTGCATTCTTTTATTGTATTCG 518
             ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 15882 GGAAGCAGTCGAGATGCCTTTGCTGGGGGAACCCTTCCTTGCATTCTTTTATTGTATTCG 15941

Query: 517   CTTCAATCGC 508
             ||||||||||
Sbjct: 15942 CTTCAATCGC 15963



Score = 587.27 bits (296.0), Expect = 9.06084e-169
Identities = 314/319 (98%)
Strand = Plus/Minus

Query: 1300   TTTTGTTGTCGGANA-TCCCTCTCCGCTTTATTAAACTCTTCTCTTAGGCGAGAGCTCAC 1242
              ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312234 TTTTGTTGTCGGAAAATCCCTCTCCGCTTTATTAAACTCTTCTCTTAGGCGAGAGCTCAC 312293

Query: 1241   TCAATTCCTTTTTAAACTTTCGCAAAGCTCTCCTTTCCTTAGAGTGAGTTGGTTTTGAAT 1182
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312294 TCAATTCCTTTTTAAACTTTCGCAAAGCTCTCCTTTCCTTAGAGTGAGTTGGTTTTGAAT 312353

Query: 1181   GAAAGCAGGTTTCATCCTGACTTTCATCGGGGACAGGTACGGGGTCTGGGTCGGTCGATA 1122
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312354 GAAAGCAGGTTTCATCCTGACTTTCATCGGGGACAGGTACGGGGTCTGGGTCGGTCGATA 312413

Query: 1121   CGATGAACGGGAAATCCAAAAATGTTGCTTCATTGAAGTCCCTCATGGAAGAAGAATTGG 1062
              |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 312414 CGATGAACGGGAAATCAAAAAATCTTGCTTCATTGAAGTCCCTCATGGAAGAAGAATTGG 312473

Query: 1061   CTGATGTAGAAGGCTTATTTGTTATCGTATCCACCACATAGTTTACATACTCAGACAGGC 1002
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 312474 CTGATGTAGAAGGCTTATTTGTTATCGTATCCACCACATAGTTTACATACTCAGACAAGC 312533

Query: 1001   TGACTCCAGCGCCTATAGT 983
              |||||||||||||||||||
Sbjct: 312534 TGACTCCAGCGCCTATAGT 312552



Score = 470.311 bits (237.0), Expect = 1.4632e-133
Identities = 308/331 (93%)
Strand = Plus/Minus

Query: 322   TTCAACCGCCCATGATTGAGACAAGCGTAAATGAGAAGAAATTCTTTTTC----ATAGTC 267
             ||||| ||||||||||||||||||  ||| ||||||||||||||||||||    ||||||
Sbjct: 15943 TTCAATCGCCCATGATTGAGACAAAGGTAGATGAGAAGAAATTCTTTTTCTTTCATAGTC 16002

Query: 266   TGTTAATTTTCTTCTTGTTGCATCTCGTCGATACGATAGGTTGATTTACCTTACTAGTCA 207
             || ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16003 TGCTAATTTTCTTCTTCTTGCATCTCGTCGATACGATAGGTTGATTTACCTTACTAGTCA 16062

Query: 206   TATGCCCTAAAGGTTTACTGTCTGGATGGTACTTTTCAACAGATAAGCGAATCGCGCTCA 147
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 16063 TATGCCCTAAAGGTTTACTGTCTGGATGGTACTTTTCAACAGATAAGCGAATCGCGCTCA 16122

Query: 146   AGTGGTGGTTGACGAAATATCTAATCCTCGTTTTCCCTGTCTGGTGTGGTC-----TTCC 92
             ||||||||||||||||||||||||||||| ||||||||||||||||||| |     ||||
Sbjct: 16123 AGTGGTGGTTGACGAAATATCTAATCCTCCTTTTCCCTGTCTGGTGTGGCCTTAGATTCC 16182

Query: 91    GCTGTCCCTTTCCGCTTCACGCAATAGCACGCTCCGAAGCAAGCGGGCTTCGCCGGTAGT 32
             |||||||||||||||||||||||||||||||||||||||||    |||||||||||||||
Sbjct: 16183 GCTGTCCCTTTCCGCTTCACGCAATAGCACGCTCCGAAGCA----GGCTTCGCCGGTAGT 16238

Query: 31    AGCCTCCTGAATTTGTCGAATAGCTTCTTTC 1
             ||||||||||||| ||||| |||||||||||
Sbjct: 16239 AGCCTCCTGAATTAGTCGACTAGCTTCTTTC 16273

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597