BLASTN 2.2.18 Mar-02-2008
Reference: Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",  Nucleic Acids Res. 25:3389-3402.

Query= Contig100
         (959 letters)
Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
         1 sequences; 430597 total letters
Searching................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gi|57013877|ref|NC_006581.1| Nicotiana tabacum mitochondrion ... 1635.9    0.0
>ref|NC_006581.1| Nicotiana tabacum mitochondrion, complete genome 

 Length = 430597


Score = 1635.93 bits (825.0), Expect = 0.0
Identities = 919/957 (96%)
Strand = Plus/Minus

Query: 953    TCCATATGATNTACTAAAGTAGATCGGTATTGNCCATATAATAAAAGCAGATCTTGNTCC 894
              |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 360407 TCCATATGATCTACTAAAGTAGATCGGTATTGACCATATAATAAAAGCAGATCTTGGTCC 360466

Query: 893    ATGGANNCCCAAGAAGGTAAGAACTCCAACCTGTCCGATGCTTNTTCGGCCAAATACGAT 834
              |||||  |||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 360467 ATGGAGTCCCAAGAAGGTAAGAACTCCAACCTGTCCGATGCTTCTTCGGCCAAATACGAT 360526

Query: 833    ATACAAGTGGGACCTGCACTATGAGCAAGCTGTGCGAAAAACCGCTTCTTTTTTCCGGTT 774
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 360527 ATACAAGTGGGACCTGCACTATGAGCAAGCTGTGCGAAAAACCGCTTCTTTTTTCCGGTT 360586

Query: 773    CCGAAACAACTTGGGCGAAATAGGGTTCTACCGGGAAACCATGGATTTTTGAGTTTTCGC 714
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 360587 CCGAAACAACTTGGGCGAAATAGGGTTCTACCGGGAAACCATGGATTTTTGAGTTTTCGC 360646

Query: 713    CATTGGTTACTGGTTGAGCCACTGGAATGGAATGAGATAAGAATCTCTGGAGATCTTTCC 654
              ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 360647 CATTGGTTACTGGTTGAGCCACTGGAATGGAATGAGATAAGAATCCCTGGAGATCTTTCC 360706

Query: 653    TCTCCACTTACTCGTAACAGGCTTTTCTTCTGTAGAAGACTTCTTCCGAATGGCATAATT 594
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 360707 TCTCCACTTACTCGTAACAGGCTTTTCTTCTGTAGAAGACTTCTTCCGAATGGCATAATT 360766

Query: 593    GTCCGACACTACGTTCCTCGATCTTCAAAGAAAACTGACTCCTCCTACTCCTCCTTCTCC 534
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 360767 GTCCGACACTACGTTCCTCGATCTTCAAAGAAAACTGACTCCTCCTACTCCTCCTTCTCC 360826

Query: 533    TTTAGGATAGGATCCTCCTTGGTTTGGTCCTTCTTTCACTAATGGTCTCACCATTTTCTA 474
              ||||||||||||||||||     |||||||||||||||||||||||||||||||||||||
Sbjct: 360827 TTTAGGATAGGATCCTCC-----TTGGTCCTTCTTTCACTAATGGTCTCACCATTTTCTA 360881

Query: 473    GTAGTAGTAGTTCGCGCGAGGGACT----TTTCTATCGCTTGCCCTTGCCTTTCACTCTC 418
              |||||||||||||||||||||||||    |||||||||||||||||||||||||||||||
Sbjct: 360882 GTAGTAGTAGTTCGCGCGAGGGACTCTCCTTTCTATCGCTTGCCCTTGCCTTTCACTCTC 360941

Query: 417    ATTTGGTCTCTTTCTTCTAAAAAATAAAGCGAAGCAAAGCGCATGGCAAAGAAGCAGCCA 358
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 360942 ATTTGGTCTCTTTCTTCTATAAAATAAAGCGAAGCAAAGCGCATGGCAAAGAAGCAGCCA 361001

Query: 357    GCTGACTGCCCCCTTCCACTCGGCCTTTCTTCGCTGTGTGAATAAGGTCTTAGTCTGTAT 298
              ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361002 GCTGCTTGCCCCCTTCCACTCGGCCTTTCTTCGCTGTGTGAATAAGGTCTTAGTCTGTAT 361061

Query: 297    GGGCATTCTGGGCAGGCCGCAATAAGTCGCTAGTCGAAGGTTTAGACCAATCGCAATTCA 238
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361062 GGGCATTCTGGGCAGGTCGCAATAAGTCGCTAGTCGAAGGTTTAGACCAATCGCAATTCA 361121

Query: 237    TCACCATCTTGCCCGCCTCCAATTGATGACTGGCTATTATATAAGTGTTGACCTAAGCCC 178
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361122 TCACCATCTTGCCCGCTTCCAATTGATGACTGGCTATTATATAAGTGTTGACCTAAGCCC 361181

Query: 177    CTGCGCAGGGGCTCGGCTCCCGAACCGTACGTGAGCTGTCTCGTACGGCTCTTCCTAAGA 118
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361182 CTGCGCAGGGGCTCGGCTCCCGAACCGTACGTGAGCTGTCTCGTACGGCTCTTCCTAAGA 361241

Query: 117    ACTTGAAGCCCCCTCTCTCTAAATAGNNNNNNNTGCATTTACAAGNNNNNNNNGACTTTT 58
              ||||||||||||||||||||||||||       ||||||||||||        |||||||
Sbjct: 361242 ACTTGAAGCCCCCTCTCTCTAAATAGAAAAAAATGCATTTACAAGACAAAAAAGACTTTT 361301

Query: 57     TCAAAAAGCCTTCGCCCGCCTATTCAACGGGGCTATTAGAGAAGCTGCTTCGTTCCT 1
              ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||
Sbjct: 361302 TCAAAAAGCCTTCGCCCTCCTATTCAACGGGGCTATTAGAGAAGCAGCTTCGTTCCT 361363



Score = 73.84 bits (37.0), Expect = 2.40679e-14
Identities = 43/45 (96%)
Strand = Plus/Minus

Query: 555    CTCCTCCTACTCCTCCTTCTCCTTTAGGATAGGATCCTCCTTGGT 511
              ||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 132717 CTCCTACTCCTCCTCCTTCTCCTTTAGGATAGGATCCTCCTTGGT 132761



Score = 73.84 bits (37.0), Expect = 2.40679e-14
Identities = 43/45 (96%)
Strand = Plus/Plus

Query: 511    ACCAAGGAGGATCCTATCCTAAAGGAGAAGGAGGAGTAGGAGGAG 555
              |||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 152131 ACCAAGGAGGATCCTATCCTAAAGGAGAAGGAGGAGGAGTAGGAG 152175



Score = 73.84 bits (37.0), Expect = 2.40679e-14
Identities = 43/45 (96%)
Strand = Plus/Minus

Query: 555    CTCCTCCTACTCCTCCTTCTCCTTTAGGATAGGATCCTCCTTGGT 511
              ||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 363989 CTCCTACTCCTCCTCCTTCTCCTTTAGGATAGGATCCTCCTTGGT 364033

  Database: /home/vicky/BKPVICKY/BLASTdb/tabaco.fasta
  Number of letters in database: 430597
  Number of sequences in database:  1

Lambda     K      H
    1.37    0.711     1.31

Matrix: BLASTN matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 1
Length of database: 430597