Original sequence

>Slmi17001F03-T7_2008-04-10_F03
NNNNNNNGNATGCTCGAGTCNTTCGCTTCCTTAAGCCATGTCCATACTAAAAGAGCTAAATCGGATGGTG
ACTAGATTCATTCCGTAGCACGGGATTCTGTAACAGCAAAAACGTTGACCCCTACTACCGGTCCCGCATT
TGAATCTGAGAAAGAAAGAGAGTCTCTCCCTAAAGCCCTAAAGTCTCATCCCACGGGCACATCTTGACTA
TGAAAAGCAGAGAGATAGATCACGCCTAAAAGCTGCCATTTCTATTAAATACGATACCACATCCGATTTG
ATTGAACTCACGGATCCAATCGCCAAGGAAAGGCCAGTCTACTGACTAGGGTTAAAAGAATTTACCCAGG
CATGGGATAAAGGGCAAGAAGAGCCGAGATGGCAAATCGAGCAGCCTATTGCGCTAACGGTAATGGATGA
AAGGGAAGAGGGACGAAGTGAAGACGGGGTTTACTCAAACGAGTTGAATAAGCAAGCCAATAAGATCAAA
TTGCTCTTGTTGAACCAGCTACTAATCACCAAGTCCTTTGTTTAGCCAAATCAGCTTGGGATAGCTTGGT
TGGTGAGAGAATTTTCGCATTCATTTGATTGATAGATGCAAAGAATTCACCTAACTAGAACTCCGCGAGT
GAACGCAAAGAAGCAAACCAGACTAGACGGAAAGAACTCCGAGTAAACAAAGCAAAAGCCCATCTGGCCG
ATCTCAAGCTGGATGAGAAGGCAAACCAACCCTCCGAAGAAGGAAACTATGACTAATTAGACCGTTAGTG
ACCAAATGACAACGTCGACATAGGAAAAGAAGGTGAGATAGGGGATGGAAGCAGGGTAGTGCTAACTCTG
CATCCGCGGCTATTTTGGCTCTTTCCGGANAGCATCAAATCANCCGCTTTCATTTGCTTNGAGANTGANC
CNCNTCCNNNNNAAAANGGGGNANNNNNCTTTNCNNNTCGATNNNNCNCCNNNNNNNNANNNNNNNNNNN
ANAANNANNNNGNNCNNNNN

Original name: Slmi17001-T7_2008-04-10_F03

Clean sequence

>Slmi17001F03-T7_2008-04-10_F03
TTCGCTTCCTTAAGCCATGTCCATACTAAAAGAGCTAAATCGGATGGTGACTAGATTCATTCCGTAGCAC
GGGATTCTGTAACAGCAAAAACGTTGACCCCTACTACCGGTCCCGCATTTGAATCTGAGAAAGAAAGAGA
GTCTCTCCCTAAAGCCCTAAAGTCTCATCCCACGGGCACATCTTGACTATGAAAAGCAGAGAGATAGATC
ACGCCTAAAAGCTGCCATTTCTATTAAATACGATACCACATCCGATTTGATTGAACTCACGGATCCAATC
GCCAAGGAAAGGCCAGTCTACTGACTAGGGTTAAAAGAATTTACCCAGGCATGGGATAAAGGGCAAGAAG
AGCCGAGATGGCAAATCGAGCAGCCTATTGCGCTAACGGTAATGGATGAAAGGGAAGAGGGACGAAGTGA
AGACGGGGTTTACTCAAACGAGTTGAATAAGCAAGCCAATAAGATCAAATTGCTCTTGTTGAACCAGCTA
CTAATCACCAAGTCCTTTGTTTAGCCAAATCAGCTTGGGATAGCTTGGTTGGTGAGAGAATTTTCGCATT
CATTTGATTGATAGATGCAAAGAATTCACCTAACTAGAACTCCGCGAGTGAACGCAAAGAAGCAAACCAG
ACTAGACGGAAAGAACTCCGAGTAAACAAAGCAAAAGCCCATCTGGCCGATCTCAAGCTGGATGAGAAGG
CAAACCAACCCTCCGAAGAAGGAAACTATGACTAATTAGACCGTTAGTGACCAAATGACAACGTCGACAT
AGGAAAAGAAGGTGAGATAGGGGATGGAAGCAGGGTAGTGCTAACTCTGCATCCGCGGCTATTTTGGCTC
TTTCCGGA

Seqclean report for Slmi17001F03-T7_2008-04-10_F03

Percentage of undetermined bases in the clear range: 0.00
5' coordinate after cleaning: 22
3' coordinate after cleaning: 869
Initial length of the sequence: 1000
Trash code:
Trimming comments (reasons for trimming/trashing): trimpoly[+21, -131];