Original sequence

>Slmi16002A02-SP6_2008-06-07_B03
NNNNNNNNNNNNNNNNNAGGGGNAGTCTTNNGTGTAAGCATAGCATTTCTGGTCGAACCCGCNCNNNNNN
NNTAAGAAGAACCGAACCTGACAGACACATCTTTTTCCTTTTGGGAGGGTACTCCGAGTAGTGGGTACCT
CGTAGGACCTCGACCCGCCTACTCGGGTCTTGTATGGATNTGCNGGAGGGGGTGCTCCTAGGTGTGTGTA
GGGGTTGTGTTTGTTCGCGAGAAAGGATTCCTCGTCAAGTAAGTTTGGGGGGTGTGGACACACTTGCGCG
AATTCGGGTAACGGCTACAAGGGAGAAATCGAAAGGAAACTGTACCCGACCAGGGATGGACGTAAACTCG
TAAGCTACCGAAGGTAGGGATAATCGTCCAGGTCTTATTGTGAAAGAAAAAAGCCGCCCCGCCACAGCAG
ACGGGTTGCTTCCTCTGTCGTCGCCGGGGAGCTCTTGGCGAGGAGACCTTAGGATAAGTTGCTAAAACAA
ACGGGATGGGAGGATCGACCCGTTCAGATAATTCCGAAGAAAGACTGTTGGCAGCAGGTAGAGAGATTTT
TTTTTCCTCTTCAAAACACAAGGAAATGCGGGCAGGGTAGAGCTCGGCAGAGGGTTCGAGAATAGGGTAG
GGTCCTGTCCTTAAGATTCAGATAAGAAAAGAGTTCCAAGCCTTTATGCTCCGTACAAGTGCTGCATACA
AGTTCCGGCCAGGATGATTGAGAAAGATTCAACCAATTTGAACCGCTCACATCACAATAGTAGTAGCGTA
AAGGCCGTAAGTCGGGGGGCGGCCATAACATAANGCTATTACTTTCACACCTCTCTCTCTCTCTGANAGA
GTGATCCGCTGCGTNNNCAACCCNNCTGTGCCTTACATGTGCTCTACNGGNCGCACGTAATCTTTCTTCC
CNANNANCCNTTTTTTTGANTTNNNANANNNNNNTNGCGNNNNNNNCNAAANGGNATGNNTTTCAGNANG
NNTNCNNANNNGGNNCNNNN

Original name: Slmi16002A02-SP6_2008-06-07_B03

Clean sequence

>Slmi16002A02-SP6_2008-06-07_B03
AGTCTTNNGTGTAAGCATAGCATTTCTGGTCGAACCCGCNCNNNNNNNNTAAGAAGAACCGAACCTGACA
GACACATCTTTTTCCTTTTGGGAGGGTACTCCGAGTAGTGGGTACCTCGTAGGACCTCGACCCGCCTACT
CGGGTCTTGTATGGATNTGCNGGAGGGGGTGCTCCTAGGTGTGTGTAGGGGTTGTGTTTGTTCGCGAGAA
AGGATTCCTCGTCAAGTAAGTTTGGGGGGTGTGGACACACTTGCGCGAATTCGGGTAACGGCTACAAGGG
AGAAATCGAAAGGAAACTGTACCCGACCAGGGATGGACGTAAACTCGTAAGCTACCGAAGGTAGGGATAA
TCGTCCAGGTCTTATTGTGAAAGAAAAAAGCCGCCCCGCCACAGCAGACGGGTTGCTTCCTCTGTCGTCG
CCGGGGAGCTCTTGGCGAGGAGACCTTAGGATAAGTTGCTAAAACAAACGGGATGGGAGGATCGACCCGT
TCAGATAATTCCGAAGAAAGACTGTTGGCAGCAGGTAGAGAGATTTTTTTTTCCTCTTCAAAACACAAGG
AAATGCGGGCAGGGTAGAGCTCGGCAGAGGGTTCGAGAATAGGGTAGGGTCCTGTCCTTAAGATTCAGAT
AAGAAAAGAGTTCCAAGCCTTTATGCTCCGTACAAGTGCTGCATACAAGTTCCGGCCAGGATGATTGAGA
AAGATTCAACCAATTTGAACCGCTCACATCACAATAGTAGTAGCGTAAAGGCCGTAAGTCGGGGGGCGGC
CATAACATAANGCTATTACTTTCACACCTCTCTCTCTCTCTGANAGAGTGATCCGCTGCGTNNNCAACCC
NNCTGTGCCTTACATGTGCTCTACNGGNCGCACGTAATCTTTCTTCCCNANNANCCNTTTTTTTGA

Seqclean report for Slmi16002A02-SP6_2008-06-07_B03

Percentage of undetermined bases in the clear range: 2.98
5' coordinate after cleaning: 24
3' coordinate after cleaning: 929
Initial length of the sequence: 1000
Trash code:
Trimming comments (reasons for trimming/trashing): trimpoly[+23, -71];