Original sequence

>SlmiAH229-16007G04L_2009-01-11_G05
NNNNNNNNNNANNCCNTGTGTNNGANCTGCACCCNAGGAAAAGTACTGCCATACCTTATCAGCACATTGA
CTCTTCAGAAAAAGATACTGCATGGTTTCCACTGTTGGTCGATTACAACACCAAGACCTTGAGGGCATTG
TATATCCAAGTCTTGTCAGAATGTCATCCAAAGAAAGGAAGTTAGCAATGCCACACTCTCCATGAGAAGA
AAGATATCTTGATTGGCAACCATAACGCTCTAACGCACGTCGTTATGGCGCTTTGGAACACTGCCGATCG
CCACCTCTTGCAAGCAACCGTCGGTCACAAATGGGAATAATCATACGCTATCATAGGCGCTTCGAATTTC
TTTGGAGATTCTCAATGCANCATGCGCTGAAATCCGCCTAGCTACTTACTACTCTACTTAACTGAAAATC
GAAAATGAAATGGAATTCAAATTGGTCNANAAAAAGAACCGCGCTAGTCGGAATTTGGGGAAAGATAGAG
AGCTCTCTAGGCTCTCCTGATCAAATTGAGAGTTCGCTTTGCCAGTCCATGAATATGCCGCACCCAGCAG
TTCGAGGANTTGGNCAGANACGGGTCGAANCCCTGNCTCNAAAAAGTCAGGANTTTTGGGNAGANTCCAG
TATCCGACCCATCTCTTTCTGNCGATTCCCCGGGNTGNCGGAATCTCTGGNTCGATCANGANCAGGAGCC
CCATTCATTCGTTTATGGGAGCGACTCTCTGNTCCCATTCTCCACCGGGTCATCNAGTGATTAGCCAGCT
CAATCCATTTTTCCATCCGATGATCTTCACCCTANGACTGANTCTGTTCGANCTGNCTTGATTGNCTANC
TAATGNTACCGTCGCAAGCNACCTCTCANGAATAGGGAGTGNACGACCCNTCTATCTAGATCGGNGANTC
CGNTCGGNNGANCCAGCTATCGAANNNCNNGNNNNNNNNACACTNANCNANNNNGCTNNNNNTNANGNNA
NNTTTTTNNNNNNNTTTTNN

Original name: 265-Slmi16007G04-16007G04L_2009-01-11_G05

Clean sequence

>SlmiAH229-16007G04L_2009-01-11_G05
CTGCACCCNAGGAAAAGTACTGCCATACCTTATCAGCACATTGACTCTTCAGAAAAAGATACTGCATGGT
TTCCACTGTTGGTCGATTACAACACCAAGACCTTGAGGGCATTGTATATCCAAGTCTTGTCAGAATGTCA
TCCAAAGAAAGGAAGTTAGCAATGCCACACTCTCCATGAGAAGAAAGATATCTTGATTGGCAACCATAAC
GCTCTAACGCACGTCGTTATGGCGCTTTGGAACACTGCCGATCGCCACCTCTTGCAAGCAACCGTCGGTC
ACAAATGGGAATAATCATACGCTATCATAGGCGCTTCGAATTTCTTTGGAGATTCTCAATGCANCATGCG
CTGAAATCCGCCTAGCTACTTACTACTCTACTTAACTGAAAATCGAAAATGAAATGGAATTCAAATTGGT
CNANAAAAAGAACCGCGCTAGTCGGAATTTGGGGAAAGATAGAGAGCTCTCTAGGCTCTCCTGATCAAAT
TGAGAGTTCGCTTTGCCAGTCCATGAATATGCCGCACCCAGCAGTTCGAGGANTTGGNCAGANACGGGTC
GAANCCCTGNCTCNAAAAAGTCAGGANTTTTGGGNAGANTCCAGTATCCGACCCATCTCTTTCTGNCGAT
TCCCCGGGNTGNCGGAATCTCTGGNTCGATCANGANCAGGAGCCCCATTCATTCGTTTATGGGAGCGACT
CTCTGNTCCCATTCTCCACCGGGTCATCNAGTGATTAGCCAGCTCAATCCATTTTTCCATCCGATGATCT
TCACCCTANGACTGANTCTGTTCGA

Seqclean report for SlmiAH229-16007G04L_2009-01-11_G05

Percentage of undetermined bases in the clear range: 2.89
5' coordinate after cleaning: 27
3' coordinate after cleaning: 821
Initial length of the sequence: 1000
Trash code:
Trimming comments (reasons for trimming/trashing): trimpoly[+26, -179];