Original sequence

>Slmi19001B12-T7_2008-09-06_D12.phd.1
NNNNNNNNNNANGCNCGAGCGGCCGCCNGTGTGNNGGANATCTGCAGAATTCAAATTGGTCGAGAAAAAG
AACCGCGCTAGTCGGAATTTGGGGAAAGATAGAGAGCTCTCTAGGCTCTCCTGATCAAATTGAGAGTTCG
CTTTGCCAGTCCATGAATATGCCGCACCCAGCAGTTCGAGGAGTTGGCCAGATACGGGTCGAAGCCCTGC
CTCGAAAAAGTCAGGACTTTTGGGCAGATTCCAGTATCCGACCCATCTCTTTCTGCCGATTCCCCGGGTT
GTCGGAATCTCTGGTTCGATCAGGACCAGGAGCCCCATTCATTCGTTTATGGGAGCGACTCTCTGTTCCC
ATTCTCCACCGGGTCATCAAGTGATTAGCCAGCTCAATCCATTTTTCCATCCGATGATCTTCACCCTAGG
ACTGACTCTGTTCGACCTGCCTTGATTGCCTAGCTAATGCTACCGTCGCAAGCAACCTCTCAAAGAATAG
GGAGTGAACGACCCTTCTATCTAGATCGGTGATTCCGTTCGGCCGAGCCAGCTATCGAAAGTCTTGCAAG
CAACCTACACTAAGCTAAGCGAGCTAGAAGCTAAAGTGAATCTTTTTTGGCATCTTTTTCTTTGCTTTGA
CCGCGACTTTGTTTGGTCTTCCTCTTTCCTTCGGCCCATGTTTCAAAGCTAGCAAAAAGTTCGAGCCTTC
GGGATCTCTCTTGAACGGCGGTCGGTCAGCCCTTTTCTTCTGTTGATGCTGAGACTGATGCTTTGACTGT
CTCCCATATCATTCGATAATAAAGATCCACTACTTGCCTTGTCGACGCTAAACTCAGTACCTCGCTTCCT
TACTAGTACACCTACNAGACCCNTACTCATTACGAATGNGNTCACCANANATCNGANNTANCANNCNNCT
GNTTAGANNNGNNNGATNNGNANNNNNNCTATGGNTNANGGGNNNTANANTCNNNGNNANGGTCAGCTCA
NTCNNANCGGANNNGNCNNN

Original name: Slmi19001B12-T7_2008-09-06_D12

Clean sequence

>Slmi19001B12-T7_2008-09-06_D12.phd.1
AAATTGGTCGAGAAAAAGAACCGCGCTAGTCGGAATTTGGGGAAAGATAGAGAGCTCTCTAGGCTCTCCT
GATCAAATTGAGAGTTCGCTTTGCCAGTCCATGAATATGCCGCACCCAGCAGTTCGAGGAGTTGGCCAGA
TACGGGTCGAAGCCCTGCCTCGAAAAAGTCAGGACTTTTGGGCAGATTCCAGTATCCGACCCATCTCTTT
CTGCCGATTCCCCGGGTTGTCGGAATCTCTGGTTCGATCAGGACCAGGAGCCCCATTCATTCGTTTATGG
GAGCGACTCTCTGTTCCCATTCTCCACCGGGTCATCAAGTGATTAGCCAGCTCAATCCATTTTTCCATCC
GATGATCTTCACCCTAGGACTGACTCTGTTCGACCTGCCTTGATTGCCTAGCTAATGCTACCGTCGCAAG
CAACCTCTCAAAGAATAGGGAGTGAACGACCCTTCTATCTAGATCGGTGATTCCGTTCGGCCGAGCCAGC
TATCGAAAGTCTTGCAAGCAACCTACACTAAGCTAAGCGAGCTAGAAGCTAAAGTGAATCTTTTTTGGCA
TCTTTTTCTTTGCTTTGACCGCGACTTTGTTTGGTCTTCCTCTTTCCTTCGGCCCATGTTTCAAAGCTAG
CAAAAAGTTCGAGCCTTCGGGATCTCTCTTGAACGGCGGTCGGTCAGCCCTTTTCTTCTGTTGATGCTGA
GACTGATGCTTTGACTGTCTCCCATATCATTCGATAATAAAGATCCACTACTTGCCTTGTCGACGCTAAA
CTCAGTACCTCGCTTCCTTACTAGTACACCTAC

Seqclean report for Slmi19001B12-T7_2008-09-06_D12.phd.1

Percentage of undetermined bases in the clear range: 0.00
5' coordinate after cleaning: 53
3' coordinate after cleaning: 855
Initial length of the sequence: 1000
Trash code:
Trimming comments (reasons for trimming/trashing): trimpoly[+39, -145]; gi|2950219|emb|Y10545.1|:<40-52>;