Contig sequence

>ContigAV049
CCGATTGCATCAAAAATGGTTGAAAATTTTTATTTTAACTTAGATATTAATGATATATTAGAAGAAATTC
CTAGTTGTCAACAAGTTGAAGATAGCATAAAAATTGAAGCTAGAAAATTGTATGATTTATGTAATGTTAA
TATAAATTTATCAAGTGAAAATGAACTTCAAATCTCTAGGACTAGATTTGATGAAGATACTACTGATACT
TATTTATATGATTATCTTGAACTTTATCACGATAAATAGAAATGATTTTGATGCCTATGTTAATCAAAAT
AAAGAACCTACTGAATATATTCTAGCATGGTGGAGAAATCACGGCAAAGGATTTCTAAAACTACAACCGA
CGGCTCGAGATATATTAGCTATGCAAGAGTTGTCAGTAGCTTCGGAAGGCGTCTTTAGTGAAGCAAGGTT
TCAACTTGGAGAACATAGGCATTCACTAGCAGCCGACAGCTTAGAGATATCAGTATTATTTCGAGATTGG
ATTAATGGCGAGAGAAAAAATTTGGATTGTGAACCACTACCGACCAAATTTTTAGATGACGTTGATGAAG
TAATGCAGGATTATAGTGACGACGGAGTTGAAGCAATGGAAGATCTATTCAACCAATTCCCGAACATGTT
ACTAAAGATATGTTAAATGATTTACGAAGGGATTTATATGGAGGCACCAACTATTAGTAAGAGTATGATA
ATTCGAGATTTAATTCAAACAGAACCCTTCCTAGAAGGTGGTTGTATAGATTAAATATTTTAATACTCTA
CTAATATTTTTGTAAATGTAATTGTAATAAT

ContigAV049 is made from:

Slmi04003D09-M13Fw.-40_2008-01-09_H06, Slmi04003D09-M13R_2007-02-03_D09