Contig sequence

>ContigAV035
CGGCCGCTTATTAAGGTACCGGGCCCCCCCGATATTCTCAGAGAGCTTTTCATTCAAAGGTATGGAGTTT
TGAAGGGCTTTACTCTTAACATTTGTTTTTCTTTGTAAATTGTTAATGGTGGTTTCTGTGGGGGAAGAAT
CTTTTGCCAGGTCCTTTTGGGTTTCGCATGTTTATTTGGGTTATTTTTCTCGACTATGGCTGACATTACT
AGGGCTTTCGTGCTTTCATCTGTGTTTTCTTCCCTTAATAGGTCTGTCTCTCTGGAATATTTAATTTTCG
TATGTAAGTTATGAGTAGTCGCTGTTTGTAATAGGCTCTTGTCTGTAAAGGTTTCAGCAGGTGTTTGCGT
TTTATTGCGTCATGTGTTTCAGAAGGCCTTTGCAGATTATTGCGTTGTACTTTAATATTTTGTCTCCAAC
CTTGTTATAGTTTCCCTCCTTTGATCTCACAGGAACCCTTTCTTCTTTGAGCATTTTCTTGTGGCGTTCT
GTAGTAATATTTTAATTTTGGGCCCGGGTTCTGAGGGTAGGTGATTATTCACAGTGATGTGCTTTCCCTA
TAAGGTCCTCTATGTGTAAGCTGTTAGGGTTTGTGCGTTACTATTGACATGTCACATGTCACATATTTTC
TTCCTCTTATCCTTCGAACTGATGGTTCTTTTTCTAATTCGTGGATTGCTGGTGCCATATTTTATTTCTA
TTGCAACTGTATTTTAGGGTGTCTCTTTCTTTTTGATTTCTTGTTAATATTTGTGTTCAGGTTGTAACTA
TGGGTTGCTAGGGTGTCTGCCCTCTTCTTTTGTGCTTCTTTCGCAGAATCTGTCCGTTGGTCTGTATTTG
GGTGATGAATTATTTATTCCTTGAAGTATCTGTCTAATTAGCTTGTGATGATGTGCAGGTATATTCGTTA
GTCATATTTCAAGGATCCGGGCCCATGGCTCCAAAGAAGAAGAGAAAGGTTGAAGACCCACGCATGGGAC
GTCCTGTAGAAACCCCAACCGTGAAATCAAAA

ContigAV035 is made from:

Slmi02001C11-M13FW_2006-08-16_G12, Slmi02001C03-M13FW_2006-08-16_G11, Slmi02001H11-M13FW_2006-08-16_H12, Slmi02001H01-M13FW_2006-08-16_F11, Slmi02001H07-M13FW_2006-08-16_D12, Slmi02001C01-M13FW_2006-08-16_E11, Slmi02001H09-M13FW_2006-08-16_F12, Slmi02001B23Fw.-40_2008-01-09_C01, Slmi02001B11-M13FW_2006-08-18_B11, Slmi02001H04-M13FW_2006-08-17_H04, Slmi02001F04-M13FW_2006-08-17_F04, Slmi02001E06-M13FW_2006-08-17_E06, Slmi02001E12-M13FW_2006-08-18_E12, Slmi02001E11-M13FW_2006-08-18_E11, Slmi02001D08-M13FW_2006-08-18_D08, Slmi02001D07-M13FW_2006-08-18_D07, Slmi02001D12-M13FW_2006-08-18_D12, Slmi02001C10-M13FW_2006-08-18_C10, Slmi02001C12-M13FW_2006-08-18_C12, Slmi02001H08-M13FW_2006-08-18_H08, Slmi02001H02-M13FW_2006-08-17_H02, Slmi02001G09-M13FW_2006-08-18_G09, Slmi02001G08-M13FW_2006-08-18_G08, Slmi02001G11-M13FW_2006-08-18_G11, Slmi02001G10-M13FW_2006-08-18_G10, Slmi02001F09-M13FW_2006-08-18_F09, Slmi02001F07-M13FW_2006-08-18_F07, Slmi02001F06-M13FW_2006-08-17_F06, Slmi02001F05-M13FW_2006-08-17_F05, Slmi02001F12-M13FW_2006-08-18_F12, Slmi02001F10-M13FW_2006-08-18_F10, Slmi02001E08-M13FW_2006-08-18_E08, Slmi02001E05-M13FW_2006-08-17_E05, Slmi02001E04-M13FW_2006-08-17_E04, Slmi02001E10-M13FW_2006-08-18_E10, Slmi02001E01-M13FW_2006-08-17_E01, Slmi02001D05-M13FW_2006-08-17_D05, Slmi02001D04-M13FW_2006-08-17_D04, Slmi02001D03-M13FW_2006-08-17_D03, Slmi02001C06-M13FW_2006-08-17_C06, Slmi02001C02-M13FW_2006-08-17_C02, Slmi02001G04-M13FW_2006-08-17_G04, Slmi02001B02-M13FW_2006-08-17_B02, Slmi02001A07-M13FW_2006-08-18_A07, Slmi02001A06-M13FW_2006-08-17_A06, Slmi02001A05-M13FW_2006-08-17_A05, Slmi02001A02-M13FW_2006-08-17_A02, Slmi02001A12-M13FW_2006-08-18_A12, Slmi02001A04-M13FW_2006-08-17_A04