Contig sequence

>ContigAV017
GCCCTTATCCAGACCCAGGAGGACACACTACACTTAATGTAATAAAGATTTTTCTAGGAGAACAAAATGA
AGCTAATTTACAGCTCTTGTCATATATCTATAATTGCTTCCAATAATTATGAATATATAGTGAATTTTTT
GCGCAAGCCGTACATATTGCGTTAACAATAATGGGGGGAGGTGGTTTTGGTTAGTTAAATATAAGTTGTA
GTTTGAGTCCTCTCGAGGACGGGCCCCCTTTTTTTGGGAAAGGATAGTGGGTAGGGCTTATCTTTCCCTT
CAACCAGCCACTCTTTTAGTTCCCAAAATATATATAATCCAGAATCCTTTTAAGCGCCTTATCACGAAAG
TGACCGAGCAAGCAGATGATTTCCCCTAAGGCACCGATGGACCAACGCCTTCGTATGTATATCACCCGAA
TTTCTTGATTCACGGCGTCGAGTATTTGCACTTTAGATCTCATGACTCGACCTGTAGACGGTGATACCGC
CACCTTTGGCGACGTGATCCTTTCTTATTCACTTGTGCTGGTGGCGGAGAGGTCGGCGCCTGTGTTCTGG
CTCTGGGGGGGTGGGTCTTCCCTTTCTCAATTATGACGTACTCGGTTAGGTTGCCATCTAGGTCTCGGTC
TGGCGCATTATTCAAGGGC

ContigAV017 is made from:

SlmiAH232116_PCR27.pTOPO.TA-M13Fw_2009-04-16_C10, SlmiAH232116_RecPCR27.pTOPO.TA-M13Fw_2009-04-17_F07, SlmiAH232116_PCR27.pTOPO.TA-M13Rv_2009-04-16_D10