Contig sequence

>ContigAV009
CTGCACCCNAGGAAAAGTACTGCCATACCTTATCAGCACATTGACTCTTCAGAAAAAGATACTGCATGGT
TTCCACTGTTGGTCGATTACAACACCAAGACCTTGAGGGCATTGTATATCCAAGTCTTGTCAGAATGTCA
TCCAAAGAAAGGAAGTTAGCAATGCCACACTCTCCATGAGAAGAAAGATATCTTGATTGGCAACCATAAC
GCTCTAACGCACGTCGTTATGGCGCTTTGGAACACTGCCGATCGCCACCTCTTGCAAGCAACCGTCGGTC
ACAAATGGGAATAATCATACGCTATCATAGGCGCTTCGAATTTCTTTGGAGATTCTCAATGCANCATGCG
CTGAAATCCGCCTAGCTACTTACTACTCTACTTAACTGAAAATCGAAAATGAAATGGAATTCAAATTGGT
CGAGAAAAAGAACCGCGCTAGTCGGAATTTGGGGAAAGATAGAGAGCTCTCTAGGCTCTCCTGATCAAAT
TGAGAGTTCGCTTTGCCAGTCCATGAATATGCCGCACCCAGCAGTTCGAGGAGTTGGCCAGATACGGGTC
GAAGCCCTGCCTCGAAAAAGTCAGGACTTTTGGGCAGATTCCAGTATCCGACCCATCTCTTTCTGCCGAT
TCCCCGGGTTGTCGGAATCTCTGGTTCGATCAGGACCAGGAGCCCCATTCATTCGTTTATGGGAGCGACT
CTCTGTTCCCATTCTCCACCGGGTCATCAAGTGATTAGCCAGCTCAATCCATTTTTCCATCCGATGATCT
TCACCCTAGGACTGACTCTGTTCGACCTGCCTTGATTGCCTAGCTAATGCTACCGTCGCAAGCAACCTCT
CAAAGAATAGGGAGTGAACGACCCTTCTATCTAGATCGGTGATTCCGTTCGGCCGAGCCAGCTATCGAAA
GTCTTGCAAGCAACCTACACTAAGCTAAGCGAGCTAGAAGCTAAAGTGAATCTTTTTTGGCATCTTTTTC
TTTGCTTTGACCGCGACTTTGTTTGGTCTTCCTCTTTCCTTCGGCCCATGTTTCAAAGCTAGCAAAAAGT
TCGAGCCTTCGGGATCTCTCTTGAACGGCGGTCGGTCAGCCCTTTTCTTCTGTTGATGCTGAGACTGATG
CTTTGACTGTCTCCCATATCATTCGATAATAAAGATCCACTACTTGCCTTGTCGACGCTAAACTCAGTAC
CTCGCTTCCTTACTAGTACACCTAC

ContigAV009 is made from:

SlmiAH229-16007G04L_2009-01-11_G05, Slmi19001B12-T7_2008-09-06_D12.phd.1