Contig sequence

>ContigAV008
CCCGGGGCAGGAGACCAAATTATTATAATAAAAAAAGTTGACTGACCTAGGCCCATAGGATGCTAAAGGA
TGCAGCTAAGCGGCCCTGGCCCTATACGAAGGCTTGTTGCCACTTTTCTACGAAGAAAGAAATCCAGCTA
AGGCTATTTCCGGGGGAAATGCTTTACTAAAAAGGTAGCCCTTTCCTAGGTAGGCTGAAGATGGCACGTA
AACTCAACCCCAAAGCGAAGGATAAAGACCTGCTGCCACTATTTAAGGAGTCGAAGTGACTGGCCTTTAT
CTTATTATACGATAATGCAGCGCAAGGAATAATTCGTATGCGCTTTCGCAGGGGTTTTCTTGGCCCTTTT
GCTTTAGCTTTCCCTTTTTTAGTATTGTAGGAACTTTCTGTCCTGAATGAAGCAATCTCTTGCTTGTAAA
GTATAGAGCTTTTATGTTCAACTCACGTATCTTTTCGTTACACTCATTCGGTTACGCAACAGGCTAAGCC
AGAAAGGAAGATAAATTGCTATTGTTGTTAGCAGTTACAGCAGAGACAGAGATAAAAGCGTAAGAAACCC
AAGAACCTTTTGGCCGCCTTTAGGTCTTCTTACCCGGATCAAATTGAACTTCGAACAATCGTAACTTTAA
AGAGAAAGAATCTGACTTCAATCCTATTGGCTTTCAACTCCCAATTCTACCTAGGAATGAAATCAATTAG
ACTTCCACGGAAGTCAGACTGAGGAAATAGTTGCAGCTCTTTTTCTTGAGTTAGAGGGATAAATCTCAAA
TTCTTACTTTCTCTTTGCTAAGGAAGAAGCCTAAGCATCAATCTCAAATGATTGGCTTTCGACTCCTATT
TCCAGGATTGAGTAAGANTGACTTCGATTTCATTCGTTTCAGTATTTCAGTAGAGCCTGTAATCAGTATA
TTTTGTTTAGGATTGANNGATTTGAAGTCAAGTAATTTCTTACCGATTTTCACTCTCTTGNTGCGCTCCT
CAGTTTTCAGTCGGAGATGCGTAATCTGAGCTAAATGCCTATGTTTGCTGAGATTCCTCGATNTAAGTCT
TTTTAAAGGCCCTCTTAAGAGTTGAGAATCAAGCTAGAGCATTTAGAACTCAACATCAGCAAATCAGTCA
TAGTCAGAAGCAGGAGGTCAGTCTTGATATTATACTAAAAGCCCTATCTTCAGACAGAGCAGAGCAGCCC
TTGAAGCGGGAGATGGTATAGTAGGCTTAGGGTGAAGTTACCTGGGAGTTACGAAAGCCGGAAATGAAGA
CTTCGATTTAGTTGCCTATTCCTCATTAGTGGGGCATAATAGCTCGAAGCCGATAGGAAGTCGNTGAGGT
AAGTTCCGATAGAGCTAGGCTCCGGGTATTCCTAAAATTTCTTCTTATAGGTTACTATTTTTTCTCTTAA
TTAAAGCACTGGAAGAGAATCGCTATCGTCTTTNTAAAGGACGGGGTGTATTGCTTATGTCCGATTTGCT
GACGCTAGCTTGACNTCACNCANTCAG

ContigAV008 is made from:

SlmiAH151-16002G11R_2009-01-11_D05, SlmiAH079-16002G11L_2009-01-11_C05