Contig sequence

>ContigAV007
TTTNCCANGATCAAGAGAGANAACGACATGATTGATAGTNTAAATAAAAAATGGGTTGNCCNCCTNTACG
ACGATGCGCCTATGCGGGAGGAGGTAAAATATGTACTAATACGGTTTTGGAAGGGCTTGGATCTTTCAGA
ACCATAAGTATCGTACTACTACTAGTGGTTCAGGTGATGTAGCAGAGGTGAATACAAATTTAGGTTCCGG
TGAGGTGAGCGCAAATAGTAGTTCAGATTCAAGTTGGTTTAGTGAGGGCGACCGCGAAAGTCACCGAATG
GCTCAGTACAGTCTCTGGGCTTTTCTGCGCTTTCATTGGATTAGTTTCCGGATAGGGAAGAAGGGTAGCA
CCATCCCGGGTGTTAGGATATATTTGTAATGTAGAATATTATGTTAATAAAAAAACACATGGAGTCATTT
TTGCATCCTTGCATCAATACCCTAGCACCGGGTATCCTTAACGCCTGCCACCAGGCCATACCCGCAATTA
CACCATACCGTCGCCATACAGTCTCATAGACCCGCATCTTTTAAAGAGACGAATTGGTACGTATGGGCTT
CCGCCATCCATCTTATCATGCGATAGGCATCTTATGCTGCGGCAAGCATACTATGATGCGACATTTATAG
GCGGGGAAGTAGCCTTGTAGTCTTGCTTGTTCATCCTCGGGGAACTGAACTCCCTTGAGATAGGAAAAAA
AAAGAGTGAGGTAGTGGACAACTAAGAAAGATTATCTTTTCAAGGCTAGAAGTGCTATAAAGGAAAGTAG
GTAGAAGAAGGAGACAAGAACTATCTTGCTATACCTGAATCAGTTTGACTCAATGCTTGCACTTGGATCT
TTCTCCCCAGCTTCTTTCTACGATTCTAGTCAAGCCCCGCTAGTATGCCTCGAGCGGCCGCCAGTGTGAT
GGATATNNGCAG

ContigAV007 is made from:

Slmi16003C06-SP6_2008-06-22_M11, Slmi16007D11-SP6_2008-06-18_H11, Slmi16008A10-SP6_2008-06-22_A20, Slmi16001A02-SP6_2008-06-07_B04, Slmi17003H08-SP6_2008-06-16_C06