Contig sequence

>ContigAV006
ANCCCTGGCTCCTCCNNCTGCTTGGGAGCTTACGCTTTCATGTTCTATTTNNCTCCNGGGGGTTCTTTAC
CCTCACGGTACTACTTCGCTATCGGTCACCCAGGAGTATTTAGCCTTGCAAGGTGGTCCTTGCTGATTCA
CACGGGATTCCACGTGCCCCATGCTACTCGGGTCAGAGCCTAAGCTAGTGATGCTTTCGGCTACTGGACT
TTCGCCATCTAGGGTGCAGCATTCGGGCTGCTTCGCCTAGCTGCACGACGCTTGTATTGCTCTCCCACAA
CCCCGTTTTCACGGTTTAGGCAGCTCCCATTTCGCCCGCCGCTACTACGGGAATCGCTTTTGCTTTCTTT
TCCTCTGGCTACTAAGATCTTTCAGTTCGCCTGGTTCTCTCTTGCCTGCCCATGGATTCAGCAGCAGTTC
GAAAGGTTGCTCCAGAGTGCCCTCCTGGGCTGCAATCCAGAAGAACTGGAAGCTCGAAAGGACCGGTCAA
AGGAATTGATCCAAAGCTCGAGTATGGTACGAGGATCCACTCCGTACCCTTTCAAGGAAGTTTAACGCAA
TGATAAGCCCCGCCTATTTATTTGCATAGTTGAAAGTCAAACGAAGCGAGGTGACAAAACAAAGAAAATC
AACAGGAGAGGAGATAGAAGCCTTAAAGGCCTGGCCGATTCCAATTCCAATAATGGTACGATGCTTTAGG
GCGGCGAGATTCCTCTTTTATGAGATTAAAGATTAAAAGATGGGATACTTTTCGAATCTGCCATAAGGGA
AAACGCGGATGAAAGAACACTTTAAGATTTATCTACGCTCAGCCAATCTCTGAGGTGAGGGTGCGACGGT
CAGTCTAGAGATTGAAAGGAAACTGAAAAAGGATACTTTATCGAATATGCCAGGCCCGCGTCTTCCATCA
GTCTAGAGAATACGGGTCTCTCAAGGGGTCGGGAACACTGTTAGCTGGATTCCAAATCAAAGAATGCAGA
CATGGGAACTGAATAGATAGCTTGGGGCACGGGAGCTTCCCTTAAGAGAAGCGTTCATTCATATGGCAGG
AGAAGGAGAGGGAGAATCAACATCTTCAGCGTAGGGAACTTTTTCTCATATTCTAGAAGTTCTAATCGCC
TCTAAGTCCAATAGCGTTCCGTTAGATAGGAACAGATTTGATAAATACTGAGAACTCTCGGATAGAGTAT
TAGAACGGAAAGATCCATTAGATAATGAACTATTGGTTCTAAGCCATCTCTGACGATTAATCAACAATTC
GAAGTGCCTTTCTTGCGTATTCTTGATAAACCAGCGTTTATATATAGATGTAGGAGGATCCATTTGGGAA
GTAAGAAGCCCCTTTGACATCTCTTCATCTGCAAATAATTCTCGATGTGAAAACACAGAGCCAGGGGGCT
GATCTTTGAATAGGAAAAAGAGTGGNNCTGCAGGGNCCAAAATGAATTGGNTTATTCGAAAAAGGNCTTG
NTCTTTGNAANANCTAT

ContigAV006 is made from:

SlmiAH112-19004A06R_2009-01-10_F10, SlmiAK241130_PCR61.pTOPO.TA-M13Rv_2009-04-16_B10, SlmiAK241130_PCR61.pTOPO.TA-M13Fw_2009-04-16_A10, Slmi16008A10-T7_2008-05-04_A20, Slmi16001A02-T7_2008-04-09_A02, Slmi16012G12-T7_2008-07-07_N23, Slmi16014F02-T7_2008-07-11_K02, Slmi16007D11-T7_2008-05-05_H21, Slmi16008C10-T7_2008-05-04_E20, Slmi16003C06-T7_2008-04-25_C06