Contig sequence

>ContigAV005
GCCCTTGCAAACCGGAGACGGACGACCACGGTCCCGGCCTTACCAGCACCGGAGGTGTACTAATCAATGA
ACCCACGAAACCAACTTTCTTTTATGACAAAATAAACCAAGCCTAAGCGGTCACGACATCTTGTTGATAT
TGATTGAGTTGGAGGGACTGGACTTTCGCTGACTGAATCCATAAACCTAGACCGCGGTAACCTTCGTAAC
CAAAGCGTCACGACAACATCCAAAGGTGACCTTTGGGTTCTTAAGTAGGGGGGCAAGGAGGAGCACGTAG
GAATGCCGACCACTACATAAGCCACTAGTGGCTGAGAGAAAGCGAGCAGCACCTTGTATAGGTTGGGCGG
AGCTTAAAGAAGCAAGCCCCTATCAGAGAAAGCCATTGCGCGCTAGCCTAGCTAGCTAACGTTTTTCAGC
TGGCTGTTATGTTAGTTGTAGCGCGCCTTCCCTCCTTCTCTCACTTTGGAAAGATTTTTCCGTATTTTCT
TATGATGACCTGGTCGAGAGAGTACGATACATCGGTGTAAAAGATTTCCTTTTTTCTGTGAGCTTGGTTT
ACTTGACCGAAGGGTGCAGTAGAACTTGAAGGAGAGGAATAAATACCTGGTCTATAATTTTGACAAAAGG
AGGACCGCTATTGGGAAATATCTTCTTGGTCGTCATCAAAGAAGTTGACGTCCGGGGCTTCCTCTTTCCC
TTTAAAATAAAAGCGGTGAAGTGAAGTCCATCCTAAAGTTCCAAATCTACATCCAACACCAGAGGTTCCT
GATGAGAACAAATTGTAAGGCGTTGAAAGAAACCCTTAAGAAAGATGTCAAGACCCTCTTTGACTTTGAT
ATAGAACACATAAAGGGGGAGAGTCACAGTCTCCCTTATTTCCTAACAATAAAATTCTTTTTTGGAAGGG
CCAGTAACAATGCGATATTCCATAGATAAGCAAGAAACTGAAGCCTCTCTTTTTATTTATGATGTACCGG
CTTGAATTCACTTTCAAGGGCG

ContigAV005 is made from:

SlmiAD217093_2008-12-12_C12, SlmiAD217093_PCR4.pTOPO.TA-M13Fw_2008-12-22_A10, SlmiAD217093_PCR4.pTOPO.TA-M13Fw_2008-12-22_B10, SlmiAD217093_PCR4.pTOPO.TA-M13Fw_2008-12-22_C10, SlmiAD217093_2008-11-25_F08