Contig sequence

>ContigAV004
TTCGCCCTTCAAGCGGATCGAGGAATGAAGGGAGAGGAATTTGAATAGAAAGAAAGAGACGTATTTCGAA
TTAGAGTAAGGGCACGCTAAGACATTCCTTTTCGTGCTTTCGATCTGCTTACTTTGAATAAAGAGAAAAA
AAAAAAAGAATAGATAGGCGGAAAGGCTTTACACAAGACCACAGAGCGAGAGAGAGAGCCTTCGCTTACC
TGCTTAACCGTACCCTCCTATCGTACCTATATAGCCTTTCCTTCAGTTATATCCAGTTTCAGTTCTGCTT
CCAACTACCGATGGGAGAAGGCTTGGACGTATAGCAAGATTAAATAAGAGGTATTGCATACGGGAATGAT
ATATGAAATGAAAGGTTGGAAACAGAGCTGGAGATGAGCGCTAGCCAATGGTTAAGACTTCAGAAAGCAC
CTTAGCAATTACCAGTAATGCCCCTATCGACCTCAGTCTTGTTTTTTGCTAGCTTGAGTTCATAACTTTA
CTATTTATCATTAAACGTAGAATATCCCGACTTCGCTAGCCAGAACGAAATGGACATATGAGCGATCGAT
TACGAGAGCTCGACCGATCAGACCGGGAAGAAGAGAAAGAAAGGTCAATCTCCGAAAGGCCTTCGCAGAG
CTGAGCTTTAGGGGGTAATACTTTTTGTGGTCTTGCACATGGAAAAGTCAAGTATTCTACGCAGGCTTGA
TTTACCGGAATTTTTGCTTCAAAGAATGCTTTCAAGCTAGGAATTTAAGCACGGATAGCTTTATTTGACA
ATTAGCTGGAAGTCGGGTATGCCTATTCAACATAGACTANNGCGCTGGGAAGGGNNGAATNNCAGCNCAC
TGGCGGNCGTNNCNAGNGGATCCGAGCTCNGNACC

ContigAV004 is made from:

SlmiAD259173_PCR7.pTOPO.TA-M13Fw_2008-12-22_C09, SlmiAD259173_2008-12-12_A12, SlmiAD259173_2008-11-25_C08, SlmiAD259173_PCR7.pTOPO.TA-M13Fw_2008-12-22_E09, SlmiAD259173_PCR7.pTOPO.TA-M13Fw_2008-12-22_D09