Contig sequence

>ContigAV003
TCCCCCNCNATCNNTCCACAAGGCTTCNGGCGACTGGAGCAACCTNNGNNNGNGCTCGGCCTTGTTCACC
CTTTCAGCTAAGTATCCCGCTTTTTCCTTGAGGGGAGCCGAGATTCAAAATATGTGGGCCTTCATCGCCT
TAAGGCAATCTATCCAAAGAGCCTACCCTATAATAGATTCAGCTAAAGCCGCGCTTGGAAGATTTCTTTC
TCAATCATGAATCCGAGCTTACTACTTGAATCACGAAAGGCGCTTTTCTCACTATCTATTCAATTTAAAA
TGCTCACTTATGAAATCAAGCTAATAAGGCCAAAAACAGAGCATGGAGTCCACTGGCATGAGAATCAAGC
GAAGTAGAGACATAAGCGGATCCAAAGAAAAGAAGCAAGACGACTACTTCCATTCCTCTCCTTAGACCGA
CAGTACTACAAGAAAGAAATAAGACAGAAATAAGGCGATTATTACCTAAAAGAATAATGTGAATTAGAAT
AATAATACCTCACAAAGAAGGTAGATGAATTGCTTAGCCAAGACTATCTCGACCTTAGCCTTCTTTTCTA
TTTAGATTCCCGTTCGTGATCCCAGCCCCGGAATCACTTCACTCCAGCGCCTCCTCAGTCTTCTTGCATC
TTTCCAGCCTTTCAAATCGACTAAGCGCCAAGCCTACTTGTGAAGAGAGGGGTCGTCGGGCTATTGCAGA
GTGAAGGAAGGTGTCTTGTCTTGGCCTAGGCCTACTTGGGTCAACACCCATAAAGTGTTGAATATCATTA
TAGTTTGTTTTTAGTATATATCTTTCTTTTATTTAATCCTGAGGTTTTTTCTAAGAATATCGTATATAGN
GNATATAGTATATGTACTTTATTGTCTAATAGACTTCTCTCTTTAGTAAGATTTTTCTTTTCATAATCAT
AATGTTTCCTTATGATTTTCTTTTTTCTAAAAANCNNNAAGTACGATTTNGAATCNAA

ContigAV003 is made from:

SlmiAD129-16006G04L_2008-12-07_J24, SlmiAD129-16002E08L_2008-12-07_B24