Contig sequence

>ContigAV002
TTGNCNTGGGAGCCCTTTCCTTACTCCTCAATATAGTCGTTCTATACNTTAAGATTTGCAGCACCTATTC
AGGAGCTGGGGAATCGGCTTGCAAGGAAAATCTTGATTGAAAGTCCATATCTTTCTATTTTCCTCTATCT
CCGGCTAGAAAAGAATGTATGCGTCAAACTTTGATGTCTCACTGGTTTAGATACGACGAGATAATCATCA
AAGTTCGGGAATCTCAACGGGAATACCTCACTGCACCGGTACCGGTTATGAGCCACATTCAGCGAAGAGT
TTCTGGTCTTTGTCCCCTTAATGCATTATAAATTGCAAGGAAAAATGAAAAAAAAGTGGAATTCTATAGG
TTTAGCTAAGACGATTTCGGAAATTCGAAACTTATTCCTTTTTTGTTTGGTGCGAGCTCAACTTAAGCTA
TACATTGCCCGAGAAGAGCGGTTTG

ContigAV002 is made from:

SlmiAD081-17002E05L_2008-12-06_H15, SlmiAD081-15001B08L_2008-12-06_L15, SlmiAD081-16002A09L_2008-10-31_H01, SlmiAH081-17002E05L_2009-01-11_G06