Contig sequence

>ContigAV001
AAATGTTCTTGGTGGATGCAGGACTTGGGACCCCCAGAATTTGTATGCAAGATGAGCTTACAGGGGTGCC
AATCAACCGAGCCACCAGGTTTGAGAATAGGGTGGGATTCCTGGATCTAGTGGCCGGTGAATCACTGATC
AAAGAGCAGATTTTGGAGAGATTCTTCATCGATCTAGTGGCCGGTGAATCACTGATCAAAGAGCGAGCAG
CCGCCAGGTTTAATGATTTGGTGGGATCTACAGATGTAGTGGCTGGTGAACCGCTTCTTCTTCTTCCACG
AAGATTCAGACAAAACCGAGCTTGGATGGAACTGAACAAGATTGAGCGAACGAAGGCAAAGATCAAAGGC
TTTATTATTGAGAAAGTAAAAGGAGGTTATTCAGTAGCCATCGCAGGTTTCATTACTTTTCTTCCATTCC
GCCGCAGAAGGAAAAGGATATTGAATAATCAATTCACCGTTGAAAACATTAACCCCAAAAAGAAGAATAT
TGTGGTCTTCTAACAAAAAAAGAAGAATATTCTGGTCTTTGAAGGAATGAAAAAAAGGAGAGACTGGTAG
AGCTCCTCTTTGTCAGCGGCAGCATTATCCCTTCTATCTATCAACCATTTCATTATGGAACTTTCTCCCC
ACAACAATCATTTTGAAAATAATGTGCAATTCATAGCCCTCGATGATCGGGCAAATGTTATGGAAAATTT
CTGTGATCAAGTATCTAGAAACATGGATGCAACTGGTCTTCAGTTGCCACCAGCATGGA

ContigAV001 is made from:

SlmiAD139-16001C08L_2009-02-20_C04, SlmiAD139-16001C08L_2008-12-11_F01, SlmiAD139-16001C08L_2008-11-07_E08, SlmiAD138-16001C08R_2008-12-11_G01, SlmiAD138-16001C08R_2009-02-20_D04