Original sequence

>Slmi04005D02-M13R_2007-02-06_D02
GTGGCTTATCGACTCACTATAGGGAAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCTACTAGTCAT
ATGGATAGACGGATTGTCTCGCTGTCACGCAGCTCTCCGAGCAAAATCACATCAGGATCTTCCCGCAATG
CGGCCCGCAATCCCGATGCGAACGTCATACAGTGCAAACCAATTTCCCGCTGCTGGATCAAACATCGCTG
GCTGGCATAGAGATATTCAACAGGATCTTCCAGCGTCAGAATATGCGCATCGGCATGTTGATTGAGATAG
CCAACCATCGCCGCCAGCGTGGTAGATTTGCCGCTCCCCGTCGCCCCCGTCACCAGAATCAGGCCATTCT
CGCTCTTGAGTAATTCCGGCAATACCGTTGGTGCGCCAAGCTGTTCGAGCTGCGGGCAGTGCGAAGGTAA
CAGCCGTAACGCCAGCGAAATGCCATGCCGTTGCGCGAATGCGCTGCCACGCAATCGCTGGTTTTCCGCC
AGCGACACGGCAAAATCCAGCTGGCCATTTTCCAGCAATATTGCCCGCTGATCGTCATCCAGCCACTCCC
GCAGTAGCTCTTCGACGTCCGGCGCATCAAACGGCGCAGCTTCCATTCGCCCGCGAATGCGCCATCGTGC
GGGCCAGGCGCTGCACAGGTGTAGATCCGAGACGTTATGCTTTACACTAAGGGCCACAATTTCTTCCATA
TTCATACTAAGATCCTCGGAAAATGAACGATATTGCGCATAACCTGGCACAGGTCCGGGACAAAATCTCA
GCGGCTGCAACGCGTTGCGGCCGTTCTCCAATCGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTC
GTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTT
TCGCCAGCTGGCGTAATAGCGAGAGGCCCGCACCGATCGCCCTTCCCAACAGTGCGCAGCCTGAATGGCG
ATGGAAATTGTAAGCGTATATTTTGTAATCGCGTAAATTTTGTAATCAGCTCATTTTTACATAGCGAAAT
CGCAATCTTTAATCAAGATAGACCGGAAGTGAGTGTGTCCAGTGGACCAGAGTCCATAGACTGATCCACT
AAGACAACGCTCAAGCATGCCCATTCGTGAC

Original name: 01415-Slmi04005D02-M13R_2007-02-06_D02


There is no clean version of this sequence since it was discarded

Seqclean report for Slmi04005D02-M13R_2007-02-06_D02

Percentage of undetermined bases in the clear range: 0.00
5' coordinate after cleaning: 801
3' coordinate after cleaning: 803
Initial length of the sequence: 1151
Trash code: CP000948.fna
Trimming comments (reasons for trimming/trashing): pMOS:<10-77>; gnl|uv|DQ391279.1:12035-12331:<826-925>; gnl|uv|L09137.2:360-494:<804-866>; gi|169887498|gb|CP000948.1|:<78-800>;