Original sequence

>Slmi04003C01-M13Fw.-40_2008-02-25
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNATNTCTCCTTCTTAAAGTTANNNN
NNTNNNNNNNNNNNNNNNAACCGTTGTGGTCTCCNNANNNNGAGNNNNNNNNNNTNCNCGGGATCGANAT
CCTGCATTAATGAATCGGCCAACGCGCGNGNNNAGGCGGTTTGCNNNTTGNGCGCTCTTCCGCTTCNNCN
CTCANNNNNNNNNNNNNNTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATAC
NGTTATCCACANAATCAGGGGATAACGCAGGAAAGAACNTGNGAGCAAAAGGCCNNNNNNNNGNNNNNAN
CCNNAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGANNNNNNTNNNNNANATCGA
CGCTCANGTCANAGGTGGNNNNNCNNNNCAGGANTATNNNGATACCAGGCGNNNNNNCCTGGAAGCTCCC
TCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGT
GGCGCTTTNNCNTANCTCACGCTGNANGTATCTCNNTTCGGTGTAGGTCGNNNGNNNNNNGCTGGGNNGN
NNGNACNAACCCCCCGTTNNNNNGACCGCNNNNNCTNNTNCGGNNNNNNNNNNNNTGNNNNNNNCCCGGT
NNNANNNANNTNNNNNNNNGGNNNNNNCCACTGNNANNNGGATNNNCNNAGCNAGGTATGNNNNNNGNGN
NNNNNNNNTNTNNNNNTGGNGNNNNNNN

Original name: placa4-M13Fw(-40)_2008-02-25_A03


There is no clean version of this sequence since it was discarded

Seqclean report for Slmi04003C01-M13Fw.-40_2008-02-25

Percentage of undetermined bases in the clear range: 35.46
5' coordinate after cleaning: 1
3' coordinate after cleaning: 798
Initial length of the sequence: 798
Trash code: low_qual