Original sequence

>Slmi06002B01-M13R_2007-02-15_B01
CGTACGTCGGCAGTGTACTACTTTCGGTAGTTATGAAAAACTTGAATCTCAGCTCTGAGCAGCTCGAGTG
CTGCAGCTATGCGAATCACGAACGAATCG

Original name: 02157-Slmi06002B01-M13R_2007-02-15_B01


There is no clean version of this sequence since it was discarded

Seqclean report for Slmi06002B01-M13R_2007-02-15_B01

Percentage of undetermined bases in the clear range: 0.00
5' coordinate after cleaning: 1
3' coordinate after cleaning: 99
Initial length of the sequence: 99
Trash code: short