Original sequence

>Slmi04004F11-M13R_2007-02-08_F11
AGGGGGGGACTTAAAAAAAAGAGAGGGAGGTGCGATCTTCCCTGAGGCCGACACTGGCTGCCTGCCCCCC
GCCGGGAAAAGGGA

Original name: 01393-Slmi04004F11-M13R_2007-02-08_F11


There is no clean version of this sequence since it was discarded

Seqclean report for Slmi04004F11-M13R_2007-02-08_F11

Percentage of undetermined bases in the clear range: 0.00
5' coordinate after cleaning: 1
3' coordinate after cleaning: 84
Initial length of the sequence: 84
Trash code: short